Untitled

Abstract

In the farming industry, the productivity of livestock herds depends on the fertility efficiency of animals. The accurate diagnosis of a broad range of aetiological agents causing fetal death is often difficult. Our aim was to assess the prevalence rates of Toxoplasma gondii, Neospora caninum, and Brucella spp. infections in ruminant abortion using bacteriological culture and molecular techniques in Mazandaran Province, northern Iran. Samples were collected from 70 aborted sheep, goat, and cattle fetuses between September 2014 and December 2015. Necropsy was performed on all the received samples, and brain tissue and abomasal content were obtained from the aborted fetuses.Protozoan infections were detected by specific polymerase chain reaction (PCR) and bacterial agents using bacteriological examinations and PCR assay.Infectious pathogens were detected in 22 out of 70 (31.4%) examined fetuses. Moreover, T. gondii, N. caninum, and B. melitensis were verified in 13 (18.6%), 4 (5.7%), and 2 (2.85%) samples, respectively. Our results showed that infection with the mentioned pathogenic agents brings about considerable fetal mortality, which can be a major cause of economic loss.The listed pathogens could be considered important etiological agents of fetal loss in Mazandaran Province, for which appropriate control measures such as vaccination and biosecurity can be implemented to prevent infection and reduce reproductive loss in livestock farms. . These parasites belong to the phylum Apicomplexa which are (Bretagne et al. 1993;Yamage et al. 1996). 81Brucella is the most important abortifacient bacterial agent with great economic importance in 82 livestock in many areas of the world. Brucellosis is still a widespread zoonotic disease and some 83 of the species of genus Brucella are pathogenic for human (Leyla et al. 2003 170 TGCCGATCACTTAAGGGCCTTCAT) (18). The PCR amplification was carried out on 1 µl of 171 genomic DNA (prepared freshly by boiling method as described above) with the following steps:172 95 0 C for 5 min as initial denaturation followed by 35 cycles at 95 0 C for 75 sec as denaturation, 177 abortus strain 544 DNA (positive controls) were also included in each reaction. Electrophoresis179 Five microliters of the PCR products were run by electrophoresis through a 1% agarose gel 180 (BioNeer, Korea) stained with Safe stain (0.5 μg/ml-Cina Gen Co, Iran) and visualized using a 181 transilluminator (UVITEC). Statistical analysis183 Statistical analyses were estimated using the chi-square test and were performed with SPSS 184 version 14.0 software (SPSS, Chicago, Illinois). RESULTS186 Findings of our study are summarized in Table 1. A total of 70 samples were collected from 187 animals associated with aborted fetuses from fourteen counties in Mazandaran providence. The 188 great majority of abortions were during the last months of gestation. There were 57 sheep, 4 goats 189 and 9 cattle. 190Protozoal infections were detected by specific PCR in 17 out of 70 (24.3%) examined fetuses 191 ( Fig. 1 and Fig. 2...