Yeast-based methods to assess PTEN phosphoinositide phosphatase activity in vivo

Rodríguez-Escudero, Isabel; Fernández-Acero, Teresa; Bravo, Ignacio; Leslie, Nicholas R.; Pulido, Rafael; Molina, Marı́a; Cid, Víctor J.

doi:10.1016/j.ymeth.2014.10.020

Cited by 13 publications

(15 citation statements)

References 31 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The PTEN-L translational variant exhibits an N-terminal extension of 173 amino acids ( Figure 1A). We have also reported that a version of PTEN-L lacking its first 22 residues (hereafter named PTEN-L*), thus excluding the cleavable N-terminal signal peptide involved in PTEN-L secretion in higher cells described by Hopkins et al [30], maintained full activity in the yeast model [39]. To further explore the properties of N-terminally extended PTEN translational variants and to study their subcellular localization, we expressed in yeast a series of these variants-namely full length PTEN-L, PTEN-L* and PTEN-M, both fused and non-fused to GFP under the control of the galactose-inducible and glucose-repressible GAL1 promoter.…”

Section: Expression Of N-terminal Extended Pten Translational Variantmentioning

confidence: 84%

“…pYES2-PTEN (amino acids 1-403) and pYES2-PTEN-L* (amino acids 22-L-576-L; amino acid nomenclature according to Pulido [32]) have been previously described [39], pYES2-PTEN-L (amino acids 1-L-576-L) was generated by PCR adding to PTEN-L* the N-terminal 21 residues, pYES2-PTEN -M.1 and pYES2-PTEN-M.2 (amino acids 28-L-576-L) were constructed by mutagenic PCR from pYES2-PTEN-L*. pYES2-GFP-PTEN-L, pYES2-GFP-PTEN-M and pYES2-GFP-PTEN-L* were constructed by amplifying GFP with the primers GFP-PTEN-L-fw (CCAAGCTTATGAGTAAA GGAGAAGAA) and GFP-PTEN-L-rv (CCAAGCTTTTTGTATAGTTCATCCATGC), both designed with HindIII flanking sites (underlined) and subsequent cloning into pYES2-PTEN-L, pYES2-PTEN -M or pYES2-PTEN-L* [39]. pYES2-PTEN-L-GFP and pYES2-PTEN-L*-GFP were constructed by subcloning PTEN-L and PTEN-L* (with HindIII/BglII flanking sites) into pYES2-GFP.…”

Section: Plasmidsmentioning

confidence: 99%

“…We have used the model eukaryotic organism S. cerevisiae to reconstitute the PI3K-PTEN mammalian pathway by heterologous expression of its main elements [39][40][41][42]. Our model has been extensively used for the analysis of pathogenic PTEN variants [43,44].…”

Section: Introductionmentioning

confidence: 99%

“…This experimental setting provides an easy readout of PTEN competence as a PIP 3 phosphatase in vivo. In our model, the expression of a version of PTEN-L lacking its N-terminal secretion signal efficiently reverted PI3K-derived toxicity [39]. Here, we use PTEN-L fusions to GFP to study in the yeast model, the determinants of PTEN-L localization and function, mapping intrinsic domains and residues that are involved in PTEN-L mitochondrial localization and in the balance between its PM attachment and its accumulation in the nucleus.…”

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Expression of Human PTEN-L in a Yeast Heterologous Model Unveils Specific N-Terminal Motifs Controlling PTEN-L Subcellular Localization and Function

Fernández-Acero

Bertalmio

Luna

et al. 2019

Cells

Self Cite

View full text Add to dashboard Cite

The tumour suppressor PTEN is frequently downregulated, mutated or lost in several types of tumours and congenital disorders including PHTS (PTEN Hamartoma Tumour Syndrome) and ASD (Autism Spectrum Disorder). PTEN is a lipid phosphatase whose activity over the lipid messenger PIP3 counteracts the stimulation of the oncogenic phosphatidylinositol 3-kinase (PI3K) pathway. Recently, several extended versions of PTEN produced in the cell by alternative translation initiation have been described, among which, PTEN-L and PTEN-M represent the longest isoforms. We previously developed a humanized yeast model in which the expression of PI3K in Saccharomyces cerevisiae led to growth inhibition that could be suppressed by co-expression of PTEN. Here, we show that the expression of PTEN-L and PTEN-M in yeast results in robust counteracting of PI3K-dependent growth inhibition. N-terminally tagged GFP-PTEN-L was sharply localized at the yeast plasma membrane. Point mutations of a putative membrane-binding helix located at the PTEN-L extension or its deletion shifted localization to nuclear. Also, a shift from plasma membrane to nucleus was observed in mutants at basic amino acid clusters at the PIP2-binding motif, and at the Cα2 and CBR3 loops at the C2 domain. In contrast, C-terminally tagged PTEN-L-GFP displayed mitochondrial localization in yeast, which was shifted to plasma membrane by removing the first 22 PTEN-L residues. Our results suggest an important role of the N-terminal extension of alternative PTEN isoforms on their spatial and functional regulation.

show abstract

Section: Expression Of N-terminal Extended Pten Translational Variantmentioning

confidence: 84%

Section: Plasmidsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Expression of Human PTEN-L in a Yeast Heterologous Model Unveils Specific N-Terminal Motifs Controlling PTEN-L Subcellular Localization and Function

Fernández-Acero

Bertalmio

Luna

et al. 2019

Cells

Self Cite

View full text Add to dashboard Cite

show abstract

“…The total number of variations (676) were sorted into four classes: null (70), autism related (16), somatic cancer associated (502), and germline hamartoma tumor syndrome (PHTS) associated (88). Null variants were derived from dbSNP (Sherry et al, 2001), the Human Gene Mutation Database (HGMD) (Stenson et al, 2014), and variants found to be active in a yeast PI3K/PTEN system (Rodriguez-Escudero et al, 2011;Rodriguez-Escudero et al, 2014). Autism-related variants and variants related to PHTS were derived from the HGMD and other individual publications.…”

Section: Variation Data and Classesmentioning

confidence: 99%

PTENpred: A Designer Protein Impact Predictor for PTEN-related Disorders

Johnston

Raines

2016

Journal of Computational Biology

View full text Add to dashboard Cite

Connecting a genotype with a phenotype can provide immediate advantages in the context of modern medicine. Especially useful would be an algorithm for predicting the impact of nonsynonymous single-nucleotide polymorphisms in the gene for PTEN, a protein that is implicated in most human cancers and connected to germline disorders that include autism. We have developed a protein impact predictor, PTENpred, that integrates data from multiple analyses using a support vector machine algorithm. PTENpred can predict phenotypes related to a human PTEN mutation with high accuracy. The output of PTENpred is designed for use by biologists, clinicians, and laymen, and features an interactive display of the threedimensional structure of PTEN. Using knowledge about the structure of proteins, in general, and the PTEN protein, in particular, enables the prediction of consequences from damage to the human PTEN gene. This algorithm, which can be accessed online, could facilitate the implementation of effective therapeutic regimens for cancer and other diseases.

show abstract

A global analysis of the reconstitution of PTEN function by translational readthrough ofPTENpathogenic premature termination codons

et al. 2021

Self Cite

View full text Add to dashboard Cite

The PTEN tumor suppressor gene is mutated with high incidence in tumors and in the germline of patients with cancer predisposition or with macrocephaly associated with autism. PTEN nonsense mutations generating premature termination codons (PTC) and producing nonfunctional truncated PTEN proteins are frequent in association with human disease. However, there are no studies addressing the restoration of full-length PTEN proteins from the PTC-mutated PTEN gene by translational readthrough. Here, we have performed a global translational and functional readthrough analysis of the complete collection of PTEN PTC somatic or hereditary mutations found in tumors or in the germline of patients (disease-associated PTEN PTCome), and we set standards for the analysis of the potential of readthrough functional reconstitution in diseaserelevant genes. Our analysis indicates that prevalent pathogenic PTEN PTC mutations are susceptible to PTEN functional restoration in response to readthrough-inducing compounds. Comprehensive readthrough analyses of disease-associated PTComes will be valuable tools for the implementation of readthrough-based precision interventions in specific groups of patients.

show abstract

Yeast-based methods to assess PTEN phosphoinositide phosphatase activity in vivo

Cited by 13 publications

References 31 publications

Expression of Human PTEN-L in a Yeast Heterologous Model Unveils Specific N-Terminal Motifs Controlling PTEN-L Subcellular Localization and Function

Expression of Human PTEN-L in a Yeast Heterologous Model Unveils Specific N-Terminal Motifs Controlling PTEN-L Subcellular Localization and Function

PTENpred: A Designer Protein Impact Predictor for PTEN-related Disorders

A global analysis of the reconstitution of PTEN function by translational readthrough ofPTENpathogenic premature termination codons

Contact Info

Product

Resources

About