Yellow Fever 17DD Vaccine Virus Infection Causes Detectable Changes in Chicken Embryos

Abstract

The yellow fever (YF) 17D vaccine is one of the most effective human vaccines ever created. The YF vaccine has been produced since 1937 in embryonated chicken eggs inoculated with the YF 17D virus. Yet, little information is available about the infection mechanism of YF 17DD virus in this biological model. To better understand this mechanism, we infected embryos of Gallus gallus domesticus and analyzed their histopathology after 72 hours of YF infection. Some embryos showed few apoptotic bodies in infected tissues, suggesting mild focal infection processes. Confocal and super-resolution microscopic analysis allowed us to identify as targets of viral infection: skeletal muscle cells, cardiomyocytes, nervous system cells, renal tubular epithelium, lung parenchyma, and fibroblasts associated with connective tissue in the perichondrium and dermis. The virus replication was heaviest in muscle tissues. In all of these specimens, RT-PCR methods confirmed the presence of replicative intermediate and genomic YF RNA. This clearer characterization of cell targets in chicken embryos paves the way for future development of a new YF vaccine based on a new cell culture system.

Kinetic Study of Yellow Fever 17DD Viral Infection in Gallus gallus domesticus Embryos

“…Specific pathogen-free (SPF) fertilized White Leghorn chicken eggs ( Gallus gallus domesticus ; Linnaeus, 1758) were obtained from the YF vaccine production unit (Fiocruz). There, eggs were infected in the yolk sac with 17DD EPlow virus seed lot (1–5 x 10 3 PFU per inoculum) on the ninth day of development [ 4 , 8 – 10 ]. Eggs were kept in an IP70 brooder (Premium Ecologica, Brazil) with controlled temperature at 37.5°C, and 55% relative humidity.…”

“…Sections of all paraffin blocks from three infected animals and three control embryo specimens per point of infection were submitted to immunofluorescence assay, as previously described [ 8 ], with a mouse polyclonal anti-yellow fever virus antibody (Evandro Chagas Institute). Double staining was performed in some samples with an anti-desmin antibody (cat.…”

“…RNA samples were extracted from formalin-fixed, paraffin-embedded tissue (FFPE). RNA was extracted from the same blocks in the immunofluorescence analysis, which were either positive or negative to the YF 17DD virus, as previously described [ 8 ]. Samples eluted after the procedure were amplified by reverse transcription-PCR (Thermoscript RT-PCR kit—cat.…”

“…11146016, Life Technologies, USA) with universal Flavivirus Yellow Fever primers (YF1–5`GGTCTCCTCTAACCTCTAG 3`and YF3- 5`GAGTGGATGACCACGGAAGACATGC 3`) [ 13 ]. Afterwards, a second amplification was carried out with yellow fever internal primers previously designed by our group [ 8 ] (YF2–5`CGAGTTTTGCCACTGCTAAGCT 3`and YF4–5`TAGACCCCGTCTTTCTACCACC 3`). Two different protocols were adopted with specific primers in RT-PCR using forward and reverse YF-1 and YF-3 primers to detect the genomic and replicative intermediate RNA.…”

“…Recently, our group [ 8 ] demonstrated by molecular techniques and immunofluorescence assays that the YFV 17DD replicates mainly in skeletal muscle tissue, and also in the nervous system, fibroblast cells and cardiomyocytes of White Legorn SPF chicken embryos at 72 hours post infection, representing a similar condition employed in yellow fever vaccine manufacture. It was possible to observe for the first time the histopathological alterations in this model and to determinate that muscle tissue could be the major site of virus replication.…”