Zebrafish protocadherin 10 is involved in paraxial mesoderm development and somitogenesis

Murakami, Tohru; Hijikata, Takao; Matsukawa, Miho; Ishikawa, Harunori; Yorifuji, Hiroshi

doi:10.1002/dvdy.20622

Cited by 32 publications

(34 citation statements)

References 39 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Thus, it may be hypothesized that the expression of different adhesion molecules and the modulation of cadherin quantity may be linked to the morphogenetic changes in somite formation. Similar conjectures have previously been put forward (Newman, 1993) and more recently (Murakami et al, 2006) for somitogenesis in zebrafish. The regulation of cell adhesion molecules has been linked to the protocadherin, papc, shown to play an important role in the formation of the epithelium along the segmental border (Rhee et al, 2003).…”

Section: Local Quantitative Framework Of the Somite Microenvironmentsupporting

confidence: 86%

From segment to somite: Segmentation to epithelialization analyzed within quantitative frameworks

Kulesa

Schnell

Rudloff

et al. 2007

Developmental Dynamics

View full text Add to dashboard Cite

One of the most visually striking patterns in the early developing embryo is somite segmentation. Somites form as repeated, periodic structures in pairs along nearly the entire caudal vertebrate axis. The morphological process involves short-and long-range signals that drive cell rearrangements and cell shaping to create discrete, epithelialized segments. Key to developing novel strategies to prevent somite birth defects that involve axial bone and skeletal muscle development is understanding how the molecular choreography is coordinated across multiple spatial scales and in a repeating temporal manner. Mathematical models have emerged as useful tools to integrate spatiotemporal data and simulate model mechanisms to provide unique insights into somite pattern formation. In this short review, we present two quantitative frameworks that address the morphogenesis from segment to somite and discuss recent data of segmentation and epithelialization.

show abstract

Section: Local Quantitative Framework Of the Somite Microenvironmentsupporting

confidence: 86%

From segment to somite: Segmentation to epithelialization analyzed within quantitative frameworks

Kulesa

Schnell

Rudloff

et al. 2007

Developmental Dynamics

View full text Add to dashboard Cite

show abstract

“…Protocadherin-10 (Pcdh10 or OLprotocadherin), although primarily expressed in the nervous system, is also present in somites and facilitates their segregation Murakami et al 2006). NFPC is expressed in ectodermal cells of the neural fold in Xenopus (Bradley et al 1998) and disruption of NFPC inhibits neural tube closure and results in disorganization of epithelial cells within the folds (Rashid et al 2006).…”

Section: Protocadherin Function In Cell Organization In Developmentmentioning

confidence: 99%

Cadherins in development: cell adhesion, sorting, and tissue morphogenesis

Halbleib¹,

Nelson²

2006

Genes Dev.

949

861

View full text Add to dashboard Cite

Tissue morphogenesis during development is dependent on activities of the cadherin family of cell-cell adhesion proteins that includes classical cadherins, protocadherins, and atypical cadherins (Fat, Dachsous, and Flamingo). The extracellular domain of cadherins contains characteristic repeats that regulate homophilic and heterophilic interactions during adhesion and cell sorting. Although cadherins may have originated to facilitate mechanical cell-cell adhesion, they have evolved to function in many other aspects of morphogenesis. These additional roles rely on cadherin interactions with a wide range of binding partners that modify their expression and adhesion activity by local regulation of the actin cytoskeleton and diverse signaling pathways. Here we examine how different members of the cadherin family act in different developmental contexts, and discuss the mechanisms involved.Cadherins were originally identified as cell surface glycoproteins responsible for Ca 2+ -dependent homophilic cell-cell adhesion during morula compaction in the preimplantation mouse embryo and during chick development (Yoshida and Takeichi 1982;Gallin et al. 1983;Peyrieras et al. 1983). Subsequently, >100 family members have been identified with diverse protein structures, but all with characteristic extracellular cadherin repeats (ECs) (Nollet et al. 2000). Cadherins are important in both simple and complex organisms. In addition to vertebrates, insects, and nematodes, members of the cadherin family are found in unicellular choanoflagellates (King et al. 2003), the diploblast Hydra (Hobmayer et al. 2000), and the sponge Oscarella carmela (Nichols et al. 2006).In the three decades since their discovery, it has become clear that the role of cadherins is not limited to mechanical adhesion between cells. Rather, cadherin function extends to multiple aspects of tissue morphogenesis, including cell recognition and sorting, boundary formation and maintenance, coordinated cell movements, and the induction and maintenance of structural and functional cell and tissue polarity. Cadherins have been implicated in the formation and maintenance of diverse tissues and organs ranging from polarization of simple epithelia, to mechanically linking hair cells in the cochlea, to providing an adhesion code for neural circuit formation during wiring of the brain (Yagi and Takeichi 2000;Gumbiner 2005). Given the breadth of their functions, it is not surprising that defective cadherin expression has also been linked directly to a wide variety of diseases including the archetypal disruption of normal tissue architecture, metastatic cancer .The large size of the cadherin family and the structural diversity of its members may have evolved to enable the many types of cell interactions required for tissue morphogenesis in complex organisms. The number of cadherins as well as distinct features of their gene structure permit precise temporal and spatial transcriptional regulation of cadherin subtypes, and variations in protein structure, particularly the cytopl...

show abstract

“…We screened a zebrafish cDNA library for molecules with homology to cadherin, which yielded a number of cadherin and protocadherin genes including cdh6 (Murakami et al, 2006). Zebrafish wt1 and pax2.1 (GenBank: wt1, AY028627; pax2.1, AF067534) were cloned by PCR using a zebrafish cDNA library and specific primers: wt1 forward ATTTGCTCTGCTCCTGAAAGTCCTC reverse GGAAACACAGTTGTTTATTGGCACC pax2.1 forward GCTTGCGGTCCCTTAAATATGTAGC reverse CAGGAAATAGTTCAGTGATGGTGCC…”

Section: Cloning Of Zebrafish Genesmentioning

confidence: 99%

Cadherin-6 is required for zebrafish nephrogenesis during early development

Kubota

Murakami

Mogi³

et al. 2007

Int. J. Dev. Biol.

Self Cite

View full text Add to dashboard Cite

We performed functional analyses of cadherin-6 (cdh6) in zebrafish nephrogenesis using antisense Morpholino oligonucleotide (MO) inhibition combined with in situ hybridization. We have cloned a zebrafish homolog (accession number AB193290) of human K-cadherin (CDH6), which showed 60-63% identity and 76-78% similarity to the human, mouse, chicken and Xenopus homologs. Whole-mount in situ hybridization showed that cdh6 is expressed in the pronephric ducts and nephron primordia in addition to the central and peripheral nervous systems. Expression of cdh6 in the pronephric ducts was first detected at 14 hours post-fertilization (hpf) and increased to 24 hpf. Embryos injected with MOs directed against cdh6 (cdh6MOs) showed developmental defects, including a small head, body axis curvature, short yolk extension and a short bent tail by 30 hpf and edema appeared in the thorax by 42 hpf. Such defects and edema became more marked by 52 hpf and most of the affected embryos died by 5 days post-fertilization. Embryos injected with cdh6MOs were subjected to in situ hybridization with probes for the pronephric markers, wt1 and pax2.1, to examine disturbed development of the anterior region of the pronephric ducts and the nephron primordia. Histological studies showed malformation of the pronephros as abnormally fused glomerulus primordia, fused or abnormally bent pronephric tubule anlagen and coarctated pronephric ducts. These results suggest that cdh6 plays pivotal roles in the development of the pronephros in zebrafish embryos.

show abstract

Zebrafish protocadherin 10 is involved in paraxial mesoderm development and somitogenesis

Cited by 32 publications

References 39 publications

From segment to somite: Segmentation to epithelialization analyzed within quantitative frameworks

From segment to somite: Segmentation to epithelialization analyzed within quantitative frameworks

Cadherins in development: cell adhesion, sorting, and tissue morphogenesis

Cadherin-6 is required for zebrafish nephrogenesis during early development

Contact Info

Product

Resources

About