Zinc Coordination and Substrate Catalysis within the Neuropeptide Processing Enzyme Endopeptidase EC 3.4.24.15

Abstract

Endopeptidase EC 3.4.24.15 (EP24.15) is a zinc metalloendopeptidase that is broadly distributed within the brain, pituitary, and gonads. Its substrate specificity includes a number of physiologically important neuropeptides such as neurotensin, bradykinin, and gonadotropinreleasing hormone, the principal regulatory peptide for reproduction. In studying the structure and function of EP24.15, we have employed in vitro mutagenesis and subsequent protein expression to genetically dissect the enzyme and allow us to glean insight into the mechanism of substrate binding and catalysis. . Conservative alterations to these residues drastically reduces enzymatic activity against both a putative physiological substrate and a synthetic quenched fluorescent substrate as well as binding of the specific active site-directed inhibitor, N-[1-(RS)-carboxy-3-phenylpropyl]-Ala-Ala-Tyr-paminobenzoate, the binding of which we have shown to be dependent upon the presence, and possibly coordination, of the active site zinc ion. These studies contribute to a more complete understanding of the catalytic mechanism of EP24.15 and will aid in rational design of inhibitors and pharmacological agents for this class of enzymes. Endopeptidase EC 3.4.24.15 (EP24.15) 1 belongs to the family of zinc metalloendopeptidases that includes among its members ACE (angiotensin-converting enzyme), EP24.11 (neutral endopeptidase), EP24.16 (neurolysin), and bacterial thermolysin (1-3). Also known as thimet oligopeptidase (4), EP24.15 is a predominantly soluble, 77-kDa, thiol-sensitive enzyme that preferentially cleaves peptide bonds on the carboxyl side of hydrophobic amino acid residues. A hydrophobic or bulky residue in the P 2 and P 3 Ј positions relative to the scissile P 1 -P 1 Ј bond (nomenclature of Schecter and Berger (5)) further contributes to substrate binding and catalytic efficiency (6, 7).Most EP24.15 activity is known to be located in brain, pituitary, and gonads (8). Within the central nervous system, EP24.15 exhibits a widespread distribution with high levels observed in areas rich in neuropeptide content such as anterior pituitary, cerebellum, hippocampus, cortex, and hypothalamus (8, 9), thus suggesting a potential role for EP24.15 in the metabolism of bioactive peptides. Of particular interest to this laboratory is the decapeptide substrate GnRH (gonadotropinreleasing hormone), the master regulatory peptide for reproduction. Several studies have previously documented the ability of EP24.15 to cleave GnRH at the Tyr 5 -Gly 6 bond in vitro (consistent with its aforementioned substrate specificity) (6,7,10,11). By using the competitive, specific active site-directed inhibitor, cFP-AAF-pAB (N-[1-(RS)-carboxy-3-phenylpropyl]-Ala-Ala-Phe-p-aminobenzoate) (12), workers (10, 13-15) have further demonstrated the potential importance of EP24.15 in the post-secretory regulation of GnRH signaling events in vivo. Other physiologically active peptides such as neurotensin and bradykinin are also cleaved at sites consistent with the substrate specificit...

Probing the catalytically essential residues of a recombinant dipeptidyl carboxypeptidase from Escherichia coli

“…Unlike similar investigations with other mammalian zinc metallopeptidases that address the functionality of one or two residues, we performed a comprehensive examination of seven residues postulated to function in the zinc coordination of EcDCP active site. The catalytic cores of neurolysin, EcDCP, and EP24.15 have revealed a binding site for divalent metal ions with two histidines and one glutamate as ligands (Cummins et al 1999;Brown et al 2001;Comellas-Bigler et al 2005). Our experimental data support this hypothesis and thus provide a vital key towards understanding the catalytic mechanism to the family M3 enzymes.…”

“…Three additional residues, Phe472, Phe500 and Pro501, located within or closely to the HEXXH motif were also mutated (Fig 1B). The close proximity of Phe500 and Pro501 to Glu499 coupled with the earlier identification of Glu502, as the third zinc ligand in EP24.15 (Cummins et al 1999) warranted their exploration as the essential residues for the catalytic mechanism.…”

“…Site-directed mutagenesis and kinetic analysis have provided an accurate identification of the catalytic residues of the zinc-dependent enzymes (Devault et al 1988;Williams et al 1994;Cummins et al 1999). Recently, we have over-expressed and characterized a recombinant DCP from E. coli Novablue (Chen et al 2009).…”

Novel Natural Peptide Substrates for Endopeptidase 24.15, Neurolysin, and Angiotensin-converting Enzyme

“…The substitution of amino acids His 474 , Glu 475 , His 477 , or Glu 502 abolishes the enzymatic activity of ep24.15 (39). The importance of the corresponding residues in ep24.16 for catalysis has not yet been experimentally demonstrated, but may be predicted from the recently determined tertiary structure (35).…”

The Neuropeptide Processing Enzyme EC 3.4.24.15 Is Modulated by Protein Kinase A Phosphorylation

“…Rat EP24.15 (accession number P24155) was expressed and purified, and site-directed mutagenesis performed using the EP24.15 expression vector, GEX-24.15 (21), as described previously (12,22). Prokaryotic codon usage rules were used to prevent the use of rare codons that may hinder expression of the mutant proteins as follows: S98A (ACATCC-GCGCAGCCGCCACAGAGGCTGACAAG), S106A (CTGACAAGAAGC-TCGCAGAGTTTGATGTGG), S172A (TCAAGAAGAGGCTGGCCCTG-CTGTGCATC), S288A (GAACATGGCCAAGACCGCTCAGACAGTAG-CCACC), S398A (GACGTGCGGCTGTACGCCGTGCGTGACGCCG), S522A (GCCACTGATGCGCATGGCCCAGCATTACCG), and S644A (CATGGATTACCGGACCGCCATCCTGAGGCCG).…”