β-III-spectrin N-terminus is required for high-affinity actin binding and SCA5 neurotoxicity

Abstract

Recent structural studies of β-III-spectrin and related cytoskeletal proteins revealed N-terminal sequences that directly bind actin. These sequences are variable in structure, and immediately precede a conserved actin-binding domain composed of tandem calponin homology domains (CH1 and CH2). Here we investigated in Drosophila the significance of the β-spectrin N-terminus, and explored its functional interaction with a CH2-localized L253P mutation that underlies the neurodegenerative disease spinocerebellar ataxia type 5 (SCA5). We report that pan-neuronal expression of an N-terminally truncated β-spectrin fails to rescue lethality resulting from a β-spectrin loss-of-function allele, indicating that the N-terminus is essential to β-spectrin function in vivo. Significantly, N-terminal truncation rescues neurotoxicity and defects in dendritic arborization caused by L253P. In vitro studies show that N-terminal truncation eliminates L253P-induced high-affinity actin binding, providing a mechanistic basis for rescue. These data suggest that N-terminal sequences may be useful therapeutic targets for small molecule modulation of the aberrant actin binding associated with SCA5 β-spectrin and spectrin-related disease proteins.

Early-phase drug discovery of β-III-spectrin actin-binding modulators for treatment of spinocerebellar ataxia type 5

“…The mNeonGreen coding sequence was synthesized at Integrated DNA Technologies and matches GenBank sequence KC295282.1. mNeonGreen was digested with KpnI and EcoRI and subcloned into pcDNA3.1-GFP-ABD L253P ( 37 ), after digestion with KpnI and EcoRI to remove GFP. mNeonGreen (mNG) and mNeonGreen-ABD L253P (mNG-ABD L253P) coding sequences were PCR amplified with the forward primer AAACACCTGCAAAAAGGTATGGTGAGCAAGGGCGAGGAGG, and the reverse primer AAATCTAGACTACTTGTACAGCTCGTCCATGCCC for mNG, or the reverse primer AAATCTAGACTACTTCATCTTGGAGAAGTAATGGTAGTAAG for mNG-ABD L253P.…”

“…Sequence-verified constructs were transformed into Rosetta 2 (DE3) Escherichia coli (Novagen). mNG and mNG-ABD L253P protein expression and purification steps, including removal of SUMO tag, were performed as described ( 37 ). A final step of buffer exchange was performed for mNG by dialysis in buffer containing 10 mM Tris, pH 7.5, 150 mM NaCl, 2 mM MgCl 2 , and 1 mM DTT using Slide-A-Lyzer, 10,000 MWCO cassettes (Thermo Scientific).…”

Identification of β-III-spectrin actin-binding modulators for treatment of spinocerebellar ataxia

“…The mNeonGreen coding sequence was synthesized at Integrated DNA Technologies and matches Genbank sequence KC295282.1. mNeonGreen was digested with KpnI and EcoRI and subcloned into pcDNA3.1-GFP-ABD L253P (32), after digestion with KpnI and EcoRI to remove GFP. mNeonGreen (mNG) and mNeonGreen-ABD L253P (mNG-ABD L253P) coding sequences were PCR amplified with the forward primer AAACACCTGCAAAAAGGTATGGTGAGCAA GGGCGAGGAGG, and the reverse primer AAATCTAGACTACTTGTACAGCTCGTCCAT GCCC for mNG, or the reverse primer AAATCTAGACTACTTCATCTTGGAGAAGTA ATGGTAGTAAG for mNG-ABD L253P.…”

“…Sequence-verified constructs were transformed into Rosetta 2 (DE3) E. coli (Novagen). mNG and mNG-ABD L253P protein expression and purification steps, including removal of SUMO tag, were performed as previously described (32). A final step of buffer exchange was performed for mNG by dialysis in buffer containing 10 mM Tris, pH 7.5, 150 mM NaCl, 2 mM MgCl 2 , and 1 mM DTT using Slide-A-Lyzer, 10,000 MWCO cassettes (Thermo Scientific).…”

“…F-actin co-sedimentation assays were performed as described previously (32) with few modifications. After measuring the concentrations of polymerized F-actin and clarified ABD proteins via Bradford assay, the binding reactions were set-up by combining 2 µM ABD protein, 1.2 µM F-actin, and 100 µM compound or DMSO, to a 60 µL total reaction volume in F-buffer (10 mM Tris, pH 7.5, 150 mM NaCl, 0.5 mM ATP, 2 mM MgCl 2 , and 1 mM DTT).…”