BackgroundThe CRISPR/Cas system is a powerful genome editing tool that enables targeted genome modifications in various organisms. In medaka (Oryzias latipes), targeted mutagenesis with small insertions and deletions using this system have become a robust technique and are now widely used. However, to date there have been only a small number of reports on targeted gene integration using this system. We thus sought in the present study to identify factors that enhance the efficiency of targeted gene integration events in medaka.ResultsWe show that longer homology arms (ca. 500 bp) and linearization of circular donor plasmids by cleavage with bait sequences enhances the efficiency of targeted integration of plasmids in embryos. A new bait sequence, BaitD, which we designed and selected by in silico screening, achieved the highest efficiency of the targeted gene integration in vivo. Using this system, donor plasmids integrated precisely at target sites and were efficiently transmitted to progeny. We also report that the genotype of F2 siblings, obtained by mating of individuals harboring two different colors of fluorescent protein genes (e.g. GFP and RFP) in the same locus, can be easily and rapidly determined non-invasively by visual observations alone.ConclusionWe report that the efficiency of targeted gene integration can be enhanced by using donor vectors with longer homologous arms and linearization using a highly active bait system in medaka. These findings may contribute to the establishment of more efficient systems for targeted gene integration in medaka and other fish species.Electronic supplementary materialThe online version of this article (doi:10.1186/s40851-017-0071-x) contains supplementary material, which is available to authorized users.

Please note that there are two errors present in the tables of the published article [1]. Firstly, the value '3' is missing from the 5th row of the 'GFP+' column of Table 1. Secondly, the gene sequence given for 'Candidate #28' in Additional file 6: Table S3 is incorrect. The gene sequence should be 'TCTTCGGCCTAGACTGCGAGG'. Additional file Additional file 6: Table S3. Potential off-target sites of 7 candidates of bait sequence that selected in the first screening and previously reported bait sequences. Potential off-target sites are defined as genomic sequence harboring up to 2 bp mismatches in the total 18 bp sequences and a NGG PAM.

This protocol describes a simple genotyping using two different colors of fluorescent protein genes inserted at the target locus. This method makes it possible to determine the genotype of each individual simply by observing the fluorescence later than F1 generation.