The DNA oligomer 5'-d(TGCGGCCTCTCAGTCCCGCAClTICATCITCC)-3' specifically recognizes Haemophilus influenzae 16S rRNA. We report here the use of this oligonucleotide, with a fluorescein label tagged on its 5' end, as a probe for the in situ detection of nonencapsulated nontypeable H. influenzae in sections of adenoid tissue from 10 children who were clinically infection free but were having their adenoids removed because of nasal obstruction. In some cases, the reticular crypt epithelium was focally infiltrated by H. influenzae. The reservoir for these bacterial colonizations, in all likelihood long standing, seemed to be macrophage-like cells found in the subepithelial layers in all 10 cases. These mononuclear cells contained up to 200 intracellular H. influenzae cells. In the transmission electron microscope, macrophage-like cells with intracellular bacteria with coccoid morphology, at least some of which were dividing, were seen. Adenoid cell suspensions, enriched for macrophages by use of paramagnetic beads coated with monoclonal antibodies against the CD14 marker, yielded up to 1,100 CFU of nontypeable H. influenzae per 105 cells after killing of

That nontypeable H. influenzae (NTHI) can reside intracellularly in human adenoid tissue has been suggested by use of in situ hybridization of a fluorescein labelled 16S rRNA-targeted oligonucleotide probe (FISH). Adenoid tissues from 43 children operated on in a clinically infection-free interval were investigated. FISH revealed H. influenzae in macrophage-like cells, located subepithelially in the crypts in all 43 adenoids. Furthermore, H. influenzae was detected in 22/22 adenoids using immunohistochemistry with the monoclonal antibody MAHI-3 recognizing a conserved H. influenzae LPS inner-core region. FISH and staining with monoclonal antibodies against immunophenotypic markers were performed simultaneously in order to characterize the cellular interrelations in this microenvironment. The findings of widespread presence of H. influenzae in cells of which some strongly expressed the CD14 marker of the monocyte/macrophage lineage may correspond to an important aspect of the colonization mechanisms whereby NTHI persists in the nasopharynx of children.

Homogenized adenoid tissue from 55 children (28-153 months) undergoing adenoidectomy because of nasopharyngeal obstruction was investigated by means of quantitative aerobic bacterial culture. The children were divided into two groups, the hypertrophy alone group--AH (n = 29)--and the hypertrophy with longstanding secretory otitis media group--SOM (n = 26). A nasopharyngeal culture was obtained preoperatively from 38 of the cases. Non-typeable H. influenzae (NTHI) was found in twice as many cases in the AH group as in the SOM group, 21/29 (72%) compared to 11/26 (42%) (p < 0.05) and in a significantly higher mean concentrations, 5.7 x 10(5) CFU/g compared to 1.9 x 10(5) CFU/g (p = 0.02). For the other aerobic potentially pathogenic bacteria no such difference was found. The bulk of the NTHI-positive cases and the cases with the highest concentrations were found in the children below the age of 6 years. In the nasopharyngeal cultures NTHI alone or together with S. pneumoniae and/or B. catarrhalis was found in 29% of the cases in both the AH group and SOM group. NTHI was found in only 50% of the nasopharyngeal cultures corresponding to a positive quantitative culture (10/20). These findings suggest that NTHI is harboured within the adenoid and could thereby chronically stimulate the local immune defense. However, the present study indicates that there is no aerobic bacterial overload in the adenoid tissue in children with SOM compared to children without middle-ear disease.

Restriction enzyme analysis of total genomic DNA was applied to study the epidemiology of nontypeable Haemophilus influenzae (NTHI) isolated from the nasopharynges of children with recurrent acute otitis media (AOM). The turnover of strains, as judged from genetic fingerprinting of a total of 213 H. influenzae isolates collected prospectively during a 2-year study period from 38 children under 3 years of age, was examined in relation to episodes of AOM as well as to courses of antibiotic treatment. The children were selected if they had had at least one episode of AOM before 1 year of age and if more than two nasopharyngeal isolates of H. influenzae were recovered. The 213 H. influenzae isolates (90% NTHI) recovered corresponded to 128 different DNA fingerprints. Fifty-eight percent of the fingerprints were observed only once, whereas 42% appeared on two or more occasions in isolates from the same individual or in close relatives, i.e., brothers and sisters. Sixty-seven percent of these strains had a minimum colonization period of 2 months or less. Intermittent nasopharyngeal colonization periods longer than 5 months could be demonstrated for 13% of the strains. The present data suggest that intermittent colonization is due to endogenous reinfections. Genetically identical NTHI strains from unrelated individuals were never identified. As expected from the observation of a relatively high proportion of persistent colonizations, no correlation was found between episodes of AOM and the acquisition of new strains of H. influenzae, nor was any direct relation between antimicrobial therapy and the elimination of nasopharyngeal colonization with a particular strain of H. influenzae observed.

A total of 117 consecutive patients with primary antibody deficiencies were followed for up to 5 years with regard to acute respiratory tract infections. Nontypeable Haemophilus influenzae (NTHI) was the sole pathogen in 61% (202/330) of the samples from which a potential pathogen was recovered. Common variable immunodeficiency (CVI) was the most prevalent condition (27/39 patients) in the group where H. influenzae was isolated. In patients where H. influenzae was not found only 9/78 patients had CVI. 49 of these 78 patients had isolated IgG3 or IgA deficiency. Both of these entities seemed to be associated with a lower prevalence of NTHI infections. 13 of 18 patients with at least 2 isolates of NTHI were colonized with the same strain from 3 to 43 months as shown by total genomic DNA-fingerprinting. Recurrent symptomatic infections occurred in these patients despite substitution therapy with gammaglobulins and repeated antibiotic treatments. All but 2 of the 224 H. influenzae isolates were beta-lactamase negative and sensitive to ampicillin. The use of 10 lipopolysaccharide-specific monoclonal antibodies in a whole cell ELISA showed that the LPS-epitopes on the 224 H. influenzae isolates from the hypogammaglobulinemic group were very similar to 499 NTHI isolates from immunocompetent patients with respiratory infections. One may therefore conclude that i) patients with CVI, were prone to be permanently colonized with NTHI, and ii) the colonizing bacteria were ordinary strains showing the same LPS-phenotypes as those strains that cause acute respiratory tract infections in immunocompetent individuals.