The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.

Interference with telomerase and telomere maintenance is emerging as an attractive target for anticancer therapies. Ligand-induced stabilization of G-quadruplex formation by the telomeric DNA single-stranded 3V overhang inhibits telomerase from catalyzing telomeric DNA synthesis and from capping telomeric ends. We report here the effects of a 3,6,9-trisubstituted acridine compound, BRACO-19, on telomerase function in vitro and in vivo. The biological activity of BRACO-19 was evaluated in the human uterus carcinoma cell line UXF1138L, which has very short telomeres (2.7 kb). In vitro, nuclear human telomerase reverse transcriptase (hTERT) expression was drastically decreased after 24 hours, induction of cellular senescence and complete cessation of growth was seen after 15 days, paralleled by telomere shortening of ca. 0.4 kb. In vivo, BRACO-19 was highly active as a single agent against early-stage (68 mm 3 ) tumors in a s.c. growing xenograft model established from UXF1138L cells, if given chronically at 2 mg per kg per day i.p. BRACO-19 produced growth inhibition of 96% compared with controls accompanied by partial regressions (P < 0.018). Immunostaining of xenograft tissues showed that this response was paralleled by loss of nuclear hTERT protein expression and an increase in atypical mitoses indicative of telomere dysfunction. Cytoplasmic hTERT expression and its colocalization with ubiquitin was observed suggesting that hTERT is bound to ubiquitin and targeted for enhanced degradation upon BRACO-19 treatment. This is in accord with a model of induced displacement of telomerase from the telomere. The in vitro and in vivo data presented here is consistent with the G-quadruplex binding ligand BRACO-19 producing an anticancer effect by inhibiting the capping and catalytic functions of telomerase. (Cancer Res 2005; 65(4): 1489-96)