The stereoisomers of a series of dinuclear ruthenium(ii) complexes [{Ru(phen)(2)}(2)(micro-BL)](4+) (phen = 1,10-phenanthroline) with flexible bridging ligands (BL) bb2 {1,2-bis[4(4'-methyl-2,2'-bipyridyl)]ethane}, bb5 {1,5-bis[4(4'-methyl-2,2'-bipyridyl)]pentane}, bb7 {1,7-bis[4(4'-methyl-2,2'-bipyridyl)]heptane}, and bb10 {1,10-bis[4(4'-methyl-2,2'-bipyridyl)]decane} have been synthesised. Their binding to a control dodecanucleotide, d(CCGGAATTCCGG)(2), and a tridecanucleotide, d(CCGAGAATTCCGG)(2), which contains a single adenine bulge have been studied using fluorescence displacement assays involving intercalating and groove-binding dyes, equilibrium dialysis and binding affinity chromatography. The fluorescence intercalator displacement (FID) assay indicated that LambdaLambda-[{Ru(phen)(2)}(2)(micro-bb7)](4+) had the greatest binding affinity with all the oligonucleotides, whereas an analogous fluorescence technique using a minor-groove binding dye, equilibrium dialysis and affinity binding chromatography showed that DeltaDelta-[{Ru(phen)(2)}(2)(micro-bb7)](4+) had the strongest binding. An (1)H NMR study of the binding of the DeltaDelta-enantiomer of [{Ru(phen)(2)}(2)(micro-bb7)](4+) to d(CCGAGAATTCCGG)(2) confirmed the selectivity of the metal complex for the bulge site and provided the basis for an energy-minimised binding model of the dinuclear ruthenium complex with the single adenine bulge containing trinucleotide. The binding model demonstrated the ability of the flexibly-linked complex to follow the curvature of the DNA minor groove.

A series of benzothiazole-substituted trisbipyridine ruthenium(II) analogues {[Ru(bpy)(2)(4,5'-bbtb)](2+), [Ru(bpy)(2)(5,5'-bbtb)](2+) and [Ru(bpy)(2)(5-mbtb)](2+) [bpy is 2,2'-bipyridine, bbtb is bis(benzothiazol-2-yl)-2,2'-bipyridine, 5-mbtb is 5-(benzothiazol-2-yl),5'-methyl-2,2'-bipyridine]} have been prepared and compared with the complex [Ru(bpy)(2)(4,4'-bbtb)](2+) reported previously. From the UV-vis spectral studies, substitution at the 5-position of the bpy causes the ligand-centred transitions to occur at considerably lower energy than for those with the functionality at the 4-position, while at the same time causing the emission to be effectively quenched. However, substitution at the 4-position causes the metal-to-ligand charge transfer to occur at lower energies. Fluorescent intercalator displacement studies indicate that the doubly substituted complexes displace ethidium bromide from a range of oligonucleotides, with the greater preference shown for bulge and hairpin sequences by the Lambda enantiomer. Since the complexes only show small variation in the UV-vis spectra on the introduction of calf thymus DNA and a small increase in fluorescence they do not appear to be intercalators, but appear to associate within one of the grooves. All of the reported bisbenzothiazole complexes show reasonable cytotoxicity against a range of human cancer cell lines.

1H NMR spectroscopy and molecular modelling have been used to investigate the binding of the DeltaDelta-and LambdaLambda-enantiomers of the dinuclear ruthenium(II) complex [[Ru(Me2bpy)2]2(mu-bpm)]4+ [Me2bpy = 4,4'-dimethyl-2,2'-bipyridine; bpm = 2,2'-bipyrimidine] to an RNA tridecanucleotide duplex containing a single-base bulge [r(CCGAGAAUUCCGG)2]], and the corresponding control dodecanucleotide [r(CCGGAAUUCCGG)2]. Both enantiomers bound the control RNA sequence weakly. From upfield shifts of the metal complex H3 and H3' protons throughout the titration of the control dodecanucleotide with DeltaDelta-[[Ru(Me2bpy)2]2(mu-bpm)]4+, a binding constant of 1 x 10(3) M(-1) was determined. In NOESY spectra of the control sequence with added DeltaDelta-[[Ru(Me2bpy)2]2(mu-bpm)]4+, NOEs were only observed to protons from the terminal base-pair residues. No significant changes in chemical shift were observed for either the metal complex or RNA protons upon addition of the LambdaLambda-enantiomer to the control dodecanucleotide. The DeltaDelta-[[Ru(Me2bpy)2]2(mu-bpm)]4+ complex bound the bulge-containing RNA with a significantly greater affinity (6 x 10(4) M(-1)) than the non-bulge control RNA duplex. Competition binding experiments indicated that the LambdaLambda-isomer bound the tridecanucleotide with similar affinity to the DeltaDelta-enantiomer. Addition of DeltaDelta-[[Ru(Me2bpy)2]2(mu-bpm)]4+ to the bulge-containing tridecanucleotide induced selective changes in chemical shift for the base H8 and sugar H1' resonances from the adenine bulge residue, and resonances from nucleotide residues adjacent to the bulge site. Intermolecular NOEs observed in NOESY spectra of the tridecanucleotide with added DeltaDelta-[[Ru(Me2bpy)2]2(mu-bpm)]4+ confirmed the selective binding of the ruthenium complex at the bulge site. Preliminary binding models, consistent with the NMR data, showed that the ruthenium complex could effectively associate in the RNA minor groove at the bulge site.

The two enantiomers of [Ru(bpy)2(bbtb)]2+{bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the Lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+{Me(2)bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association with hairpin oligonucleotides, again with the Lambda enantiomer binding more strongly. A (1)H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

We have observed a number of discrepancies and contradictions in the use of a fluorescent intercalator displacement assay in surveying the binding affinities of dinuclear polypyridyl ruthenium(II) complexes with DNA. By a modification of the assay using the fluorescent minor-groove binder 4',6-diamidino-2-phenylindole, rather than intercalating dyes (ethidium bromide or thiazole orange), results were obtained for all complexes studied which were consistent with relative affinities and stereoselectivities observed with other techniques, including NMR, affinity chromatography and equilibrium dialysis. It is believed that the difference in binding mode between the minor groove-binding Ru(II) complexes and the intercalating fluorescent dyes they are displacing may contribute to these discrepancies.