Several findings from Argentina provide compelling evidence of the need for more rational use of antimicrobial agents. Thus, a multidisciplinary antimicrobial treatment committee for the development of a hospital-wide intervention program was formed to optimize the quality of antibiotic use in hospitals. Four successive steps were developed during 6-month periods: baseline data collection, introduction of a prescription form, education, and prescribing control. Sustained reduction of drug consumption was shown during the study (R2=0.6885; P=.01). Total cost savings was 913,236 US dollars. To estimate the consumption of cefepime and aminopenicillin-sulbactam in relation to that of the third-generation cephalosporins, 2 indices were calculated: Icfp and Iams, respectively. Decreasing resistance to ceftriaxone by Proteus mirabilis and Enterobacter cloacae proved to be associated with increasing Icfp. Decreasing rates of methicillin-resistant Staphylococcus aureus were related to increasing Iams. The present study indicates that a systematic program performed by a multidisciplinary team is a cost-effective strategy for optimizing antibiotic prescribing.

BackgroundThe impact of neuraminidase inhibitors (NAIs) on influenza‐related pneumonia (IRP) is not established. Our objective was to investigate the association between NAI treatment and IRP incidence and outcomes in patients hospitalised with A(H1N1)pdm09 virus infection.MethodsA worldwide meta‐analysis of individual participant data from 20 634 hospitalised patients with laboratory‐confirmed A(H1N1)pdm09 (n = 20 021) or clinically diagnosed (n = 613) ‘pandemic influenza’. The primary outcome was radiologically confirmed IRP. Odds ratios (OR) were estimated using generalised linear mixed modelling, adjusting for NAI treatment propensity, antibiotics and corticosteroids.ResultsOf 20 634 included participants, 5978 (29·0%) had IRP; conversely, 3349 (16·2%) had confirmed the absence of radiographic pneumonia (the comparator). Early NAI treatment (within 2 days of symptom onset) versus no NAI was not significantly associated with IRP [adj. OR 0·83 (95% CI 0·64–1·06; P = 0·136)]. Among the 5978 patients with IRP, early NAI treatment versus none did not impact on mortality [adj. OR = 0·72 (0·44–1·17; P = 0·180)] or likelihood of requiring ventilatory support [adj. OR = 1·17 (0·71–1·92; P = 0·537)], but early treatment versus later significantly reduced mortality [adj. OR = 0·70 (0·55–0·88; P = 0·003)] and likelihood of requiring ventilatory support [adj. OR = 0·68 (0·54–0·85; P = 0·001)].ConclusionsEarly NAI treatment of patients hospitalised with A(H1N1)pdm09 virus infection versus no treatment did not reduce the likelihood of IRP. However, in patients who developed IRP, early NAI treatment versus later reduced the likelihood of mortality and needing ventilatory support.

SummaryOur findings suggest that in populations at high risk for hospital admission, patients with laboratory-confirmed or clinically diagnosed A(H1N1)pdm09 infection, NAI treatment in the community or outpatient settings is associated with reduced likelihood of subsequent hospital admission.

We have previously observed a significant reduction of ceftriaxone resistance in Proteus mirabilis associated with an increase in the use of cefepime, along with a decrease in the consumption of broad-spectrum cephalosporins (CEP). However, we did not observe such a reduction with Klebsiella pneumoniae. Therefore, we sought to determine whether replacement of CEP by piperacillin-tazobactam might be useful in reducing sustained high rates of CEP resistance by this organism. We used a 6-month "before and after model"; during the second (intervention) period, most prescriptions of CEP were changed to piperacillin-tazobactam at the pharmacy. No additional barrier precautions were undertaken. During intervention, consumption of ceftazidime decreased from 17.73 to 1.14 defined daily doses (DDD) per 1,000 patient-days (P < 0.0001), whereas that of piperacillin-tazobactam increased from 0 to 30.57 DDD per 1,000 patient-days (P < 0.0001). The levels of resistance to CEP by K. pneumoniae and P. mirabilis decreased from 68.4 and 57.9% to 37.5 and 29.4%, respectively (P < 0.05). We conclude that replacement of ceftazidime by piperacillin-tazobactam might be a suitable strategy to decrease endemic CEP resistance by K. pneumoniae and P. mirabilis, even where there are high bacterial resistance rates and irrespective of any additional precautions for controlling nosocomial infection.

It is demonstrated that a diagnostic PCR for Borrelia burgdorferi can be inhibited in the presence of more than 500 ng of host (monkey skin) DNA. The inhibitor is the host DNA itself. An acceptable value for analytical sensitivity can be obtained by diluting the skin-B. burgdorferi proteinase K lysate to a level below the inhibitory concentration of the host DNA. Dilution of the lysate may obviate the need for further DNA purification. PCR is frequently used diagnostically to detect Borrelia burgdorferi, the spirochete that causes Lyme disease, in the skin of human patients (4, 5, 8, 10-14). Initial attempts to detect by PCR B. burgdorferi DNA in skin samples which had been isolated from experimentally infected rhesus monkeys and shown to contain cultivable spirochetes (7, 9) were unsuccessful. Thus, a systematic study was undertaken to evaluate the factors that could conceivably suppress the PCR for the detection of B. burgdorferi. PCR. Oligonucleotide primers which amplify a 231-bp region of the Ly1 chromosomal gene of B. burgdorferi (5ЈGAAATG GCTAAAGTAAGCGGAATTGTAC3Ј and 5ЈCAGAAATTCT GTAAACTAATCCCACC3Ј) were used (2). Optimal reagent concentrations in a 100-l reaction volume were 1.6 mM MgCl 2 , 200 M each deoxynucleoside triphosphate, 2 U of Taq polymerase (Amplitaq; Perkin-Elmer, Norwalk, Conn.), and 40 pmol of each primer. The thermocycler program was 94ЊC for 45 s, 55ЊC for 45 s, and 72ЊC for 45 s for 40 cycles. The first cycle included an extended melting time of 4 min at 94ЊC, and the final cycle contained an extension time of 7 min at 72ЊC. A DNA fragment generated by PCR with the primer sequences 5ЈGATGAGTATGGGGTTGAACATAAGCATT3Ј and 5ЈCA CATCATGAGGATTAATTCTACC3Ј, which flanked a 122-bp region within the parent 231-bp amplicon, was labeled with horseradish peroxidase with the Amersham enhanced chemiluminescence kit (Amersham, Arlington Heights, Ill.) and used as a probe on Southern blots of amplified DNA; blotting was performed as recommended by the kit's manufacturer. Tissue samples. Samples of skin taken from uninfected rhesus monkeys at necropsy, with or without added spirochetes, were lysed with proteinase K (0.1 mg/ml; Stratagene, La Jolla, Calif.) in lysis buffer (100 mM NaCl, 10 mM Tris-HCl, 25 mM EDTA, 0.5% sodium dodecyl sulfate [pH 8.0]) for 4 h at 50ЊC. DNA was extracted with phenol-chloroform-isoamyl alcohol by standard methods, resuspended in 20 l of Tris-EDTA buffer, and quantified on a spectrophotometer. Results of diagnostic PCRs with rhesus monkey skin samples obtained from animals known to be infected with B. burgdorferi and shown to contain spirochetes by in vitro culture yielded