Salmonella spp. merupakan penyebab infeksi utama pada manusia melalui rute oral dengan cara mengkontaminasi makanan dan minuman. Penyakit yang disebabkan oleh Salmonella spp. disebut salmonellosis. Salmonella spp. memiliki gen invA yang menyebabkan patogen pada manusia. Deteksi gen InvA dapat dilakukan dengan metode PCR. Tujuan penelitian ini adalah untuk pengembangan metode deteksi cepat Gen InvA pada Salmonella spp. dengan metode PCR. Tahapan metode penelitian dimulai dari kultur Salmonella ATCC, Isolasi DNA Salmonella ATCC, Analisis Kuantitatif DNA Salmonella ATCC, Desain primer spesifik untuk deteksi gen InvA, Karakterisasi primer, Optimasi komponen PCR. Hasil isolasi DNA Salmonella ATCC yang didapat dengan konsentrasi DNA sebesar 4,5 ng/ul dengan kemurnian DNA 1,66. Primer PCR yang telah didesain untuk deteksi gen InvA terdiri dari satu pasang primer, yaitu InvA-F: 5’ TCGTCATTCCATTACCTACC 3’dan InvA-R: 5’ AAACGTTGAAAAACTGAGGA 3’ yang menghasilkan produk PCR gen InvA sepanjang 119 bp. Gen InvA dapat dideteksi dengan cepat menggunakan metode PCR yang telah dioptimasi komponen PCR.

Basil is one of medicinal plants in Indonesia that has been used empirically as antimicrobes, analgetic, antiinflammatory, antivirus, antitumor, and antioxidants that prevented ischemia. This research aimed to investigate the effect of adding granule ethanol extract of basil leaves (Ocimum americanum) as antioxidant to capture free radicals in fried foods. The antioxidant activity of ethanol extract of basil leaves with DPPH determinated by IC 50 , comparing the antioxidant activity of the granule and the control by determination of quality properties of oil and food after frying using Fourier Transfor Infra Red (FTIR) spectra, and quantitative parameters by determination percentage of free fatty acid (FFA). Results of maceration with ethanol 15.94% w/w, total ash content 9.85%, water soluble ash content 3.98%, acid insoluble ash content 3.98%, water soluble extract 25.89%, ethanol soluble extract 12.76%, water content 6.87%, drying shrinkage 11.19%. Testing the antioxidant activity of the ethanol extract of basil leaves with DPPH gave IC 50 of 80.55 ppm.

Infectious diseases are caused by bacteria and fungi in developing countries are still high. One of the microorganisms that cause infections are Escherichia coli. E. coli can lead to infection of the digestive tract. Improper use of antibiotics can lead to resistance. This can be minimized by making use of traditional medicine. One of the traditional medicine that the mangosteen fruit. Secondary metabolites can be isolated by utilizing endophytic bacteria. Endophytic bacteria are bacteria that live inside plant tissues and capable of producing the active compounds which are antibiotics, antimalarial and antifungal. The methodology carried out: preparation of materials and determination, isolation of endophytic bacteria, screening endophytic bacteria producing antibacterial, morphological and biochemical identification, endophytic bacteria fermentation, the manufacture of standard curve, the compound fermented inspection (inspection: phenols, saponins, flavonoids, alkaloids and terpenoids/steroid), test the antimicrobial activity microdilution method. The result of morphological and biochemical tests showed that bacteria EKM 1 and EKM 2 is a Gram negative, motile, facultative anaerobic, produces gelatinase and protease enzymes. Antibacterial activity test microdilution method showed the presence of bacterial growth inhibition test. The endophytic bacteria isolated from mangosteen rind suspected Enterobacter. Antibacterial test results using microdilution method produces the MIC value 1024 ppm against E. coli bacteria.