A chimeric protein consisting of a divalent pertussis toxin (PT) S1 fragment linked to the cholera toxin (Ctx) A 2 B fragment was constructed. The chimera induced a mucosal immunoglobulin A (IgA) and a serum IgG immune response to PT and CtxB in BALB/c mice following intranasal immunization. The immune sera neutralized PT in vitro. In the mouse model of Bordetella pertussis respiratory infection, the chimera-immunized animals showed a significant reduction in bacterial lung counts (P ‫؍‬ 0.01) from that of the sham control group. Thus, a divalent S1 fragment CtxA2B chimera is an immunogenic antigen and can elicit a protective immunity.Pertussis is a severe respiratory disease caused by Bordetella pertussis. Among the virulence factors produced by B. pertussis, pertussis toxin (PT) is one of most important (18) and is the prominent component of all acellular pertussis vaccines, which are given parenterally. The A-protomer (S1 subunit) of PT is immunodominant (4). Antibodies against the S1 subunit have been shown to neutralize the toxin in vitro and protect mice from B. pertussis infection in aerosol and intracerebral challenges (7,16,17).Cholera toxin (Ctx) is also an AB toxin in which the toxic A1 moiety (22 kDa) is linked to the pentameric B subunit (CtxB) (11 kDa) by an A2 fragment (5 kDa) which is derived from the proteolytic cleavage of the C terminus of the A subunit (5, 14). CtxB binds to the G M1 ganglioside and can serve as a mucosal adjuvant (6, 12). Hajishengalis et al. (6) previously have shown that the A1 moiety can be replaced by a saliva-binding region (SBR) of the Streptococcus mutans antigen I/II, and the chimera induced an excellent immune response to SBR when given orally to mice.A mucosal pertussis vaccine offers a number of potential advantages over the conventional parenteral vaccines, such as the ease in administration and the generation of mucosal antibodies that can prevent colonization by B. pertussis. However, induction of a protective antibody immune response at mucosal surfaces is not readily achieved by parenteral or mucosal immunization with soluble antigens. Since CtxB is an excellent mucosal adjuvant, we exploited this property to deliver the PT S1 fragment to the mucosal immune system. Construction of the MBPS1S1CtxA2B chimera. Two copies of the DNA coding for the N-terminal 179-amino-acid sequence of the PT S1 subunit were cloned in tandem into the middle portion of spaP by ligating a 1.4-kb SmaI-KpnI fragment from pPTS1 into the NruI-KpnI sites of pRJMI (11). The DNA coding for the CtxA2 motif and CtxB was then cloned downstream to the SpaPS1S1 construct using the NruI-KpnI sites. The CtxA2B DNA was amplified from pRIT10814 (13) using Taq DNA polymerase and the primers SL155 (AT GATATCGCTTGGAGGGAAGAG; EcoRV site underlined) and SL156 (ACGGTACCATAATACGCACTAAGG; KpnI site underlined) under conditions described previously (8). The cloning placed the CtxA2 sequence in-frame to the S1 sequence, creating the DNA coding for the SpaPS1S1CtxA2 fusion as one gene and ctxB as a second gen...