We conducted minisatellite-associated sequence amplification (MASA) with an oligo (5' CACCTCTCCACCTGCC 3') based on consensus of 33.15 repeat loci using cDNA from the testis, ovary, spleen, kidney, heart, liver, and lung of water buffalo Bubalus bubalis and uncovered 25 amplicons of six different sizes (1,263, 846/847, 602, 576, 487, and 324 base pairs). These fragments, cloned and sequenced, were found to represent several functional, regulatory, and structural genes. Blast search of all the 25 amplicons showed homologies with 43 transcribing genes across the species. Of these, the 846/847-bp fragment, having homology with the adenylate kinase gene, showed nucleotide changes at six identical places in the ovary and testis. The 1,263; 324; and 487-bp fragments showed homology with the secreted modular calcium binding protein (SMOC-1), leucine-rich repeat neuronal 6A (LRRN6A) mRNA, and human TTTY5 mRNA, respectively. Real-time PCR showed maximum expression of AKL, LRRN6A, and T-cell receptor gamma (TCR-gamma)-like genes in the testis, SMOC-1 in the liver, and the T-cell receptor-like (TCRL) gene in the spleen compared to those used as endogenous control. We construe that these genes have evolved from a common progenitor and conformed to various biological functions during the course of evolution. MASA approach coupled with real-time PCR has potentials to uncover accurate expression of a large number of genes within and across the species circumventing the screening of cDNA library.

We assessed genomic instability of 3.4 kb DYZ1 repeat arrays in patients encompassing prostate cancer (PC), cases of repeated abortion (RA) and males exposed to natural background radiation (NBR) using real-time PCR and fluorescence in situ hybridization (FISH). Normal males showed DYZ1 copies ranging from 3000 to 4300, RA, 0-2237; PC, 550; and males exposed to NBR, 1577-5700. FISH showed organizational variation of DYZ1 in these samples substantiating the data obtained from real-time PCR. Of the 10 RA samples, 7 were found to be affected of which, 5 showed deletion of 265 bp from nt 25 to 290 and 773 bp from 1347 to 2119 and 2 showed deletion of 275 bp from nt 3128 to 3402. Copy number variation of DYZ1 in these males correlated with genetic constrains/anomalies. Although precise mechanisms of genomic instability of DYZ1 remains unclear, we construe that this repeat plays a critical role in maintaining the structural integrity of the Y chromosome, possibly by absorbing the load of mutations. This may be used as a marker system to analyze genetic integrity of the DYZ1 repeat array(s) across the spectrum of patients.

Minisatellites have been implicated with chromatin organization and gene regulation, but mRNA transcripts tagged with these elements have not been systematically characterized. The aim of the present study was to gain an insight into the transcribing genes associated with consensus of 33.6 repeat loci across the tissues in water buffalo, Bubalus bubalis. Using cDNA from spermatozoa and eight different somatic tissues and an oligo primer based on two units of consensus of 33.6 repeat loci (5' CCTCCAGCCCTCCTCCAGCCCT 3'), we conducted minisatellite-associated sequence amplification (MASA) and identified 29 mRNA transcripts. These transcripts were cloned and sequenced. Blast search of the individual mRNA transcript revealed sequence homologies with various transcribing genes and contigs in the database. Using real-time PCR, we detected the highest expression of nine mRNA transcripts in spermatozoa and one each in liver and lung. Further, 21 transcripts were found to be conserved across the species; seven were specific to bovid whereas one was exclusive to the buffalo genome. The present work demonstrates innate potentials of MASA in accessing several functional genes simultaneously without screening the cDNA library. This approach may be exploited for the development of tissue-specific mRNA fingerprints in the context of genome analysis and functional and comparative genomics.

The long arm of the human Y chromosome is flecked with various fractions of repetitive DNA. DYZ1 is one such fraction, which is organized tandemly as an array of a 3.4-kb repeat ranging from 2000-4000 copies in normal males. We have studied the organizational variation of the DYZ1 fraction on the human Y chromosome using DNA samples from CEPH family members and the random population employing the RFLP approach, fluorescence in situ hybridization (FISH), and conducted a similarity search with GenBank sequences. Typing of genomic DNA using DYZ1 as a probe showed an allele length and copy number variations even between two male siblings. Hybridization of DNA from monochromosome hybrids with this probe showed its presence on chromosome 15 in addition to the Y chromosome. Fluorescence in situ hybridization of metaphase chromosomes from an apparently normal male showed DYZ1 sequences in the proximal region of chromosome 11 in addition to the long arm of the Y chromosome. Typing of sets of semen and blood DNA samples from the same human individuals showed discernible allelic variation between the two samples, indicating tissue-specific programmed sequence modulation. DYZ1 seems to be the first probe having the unique potential to discriminate unequivocally the difference between the DNA originating from semen and blood samples, and may be exploited in forensic cases. This probe may also be used as a diagnostic tool to ascertain Y chromosome mosaicism in patients (e.g., Turner), its aberrant status in somatic cells, and possible sequence modulation/rearrangement in the germline samples. Additionally, this can be used to uncover sequence polymorphism in the human population.

Higher eukaryotes contain a wide variety of repetitive DNA, although their functions often remain unknown. We describe cloning, chromosomal localization, copy number assessment, and transcriptional status of 1378- and 673-bp repeat fractions in the buffalo genome. The pDS5, representing the 1378-bp fragment, showed FISH signals in the centromeric region of acrocentric chromosomes only, whereas pDS4, corresponding to 673 bp, detected signals in the centromeric regions of all the chromosomes. Crosshybridization studies of pDS5 and pDS4 with genomic DNA from different sources showed signals only in buffalo, cattle, goat, and sheep. Real-time PCR analysis uncovered 1234 and 3420 copies of pDS5 and pDS4 fragments per the haploid genome, corresponding to 30 and 68 copies per chromosome, respectively. Analysis of cDNA from different tissues of buffalo with Real-time PCR showed maximum expression of pDS5 and pDS4 in the spleen and liver, respectively. Phylogenetic analysis of these sequences showed a close relationship between buffalo and cattle. The prospect of this approach in comparative genomics is highlighted.