Graphic abstract The current coronavirus disease (COVID-19) pandemic remains one of the most serious public health problems. Increasing evidence shows that infection by severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) causes a very complex and multifaceted disease that requires detailed study. Nevertheless, experimental research on COVID-19 remains challenging due to the lack of appropriate animal models. Herein, we report novel humanized mice with Cre-dependent expression of hACE2, the main entry receptor of SARS-CoV-2. These mice carry hACE2 and GFP transgenes floxed by the STOP cassette, allowing them to be used as breeders for the creation of animals with tissue-specific coexpression of hACE2 and GFP. Moreover, inducible expression of hACE2 makes this line biosafe, whereas coexpression with GFP simplifies the detection of transgene-expressing cells. In our study, we tested our line by crossing with Ubi-Cre mice, characterized by tamoxifen-dependent ubiquitous activation of Cre recombinase. After tamoxifen administration, the copy number of the STOP cassette was decreased, and the offspring expressed hACE2 and GFP , confirming the efficiency of our system. We believe that our model can be a useful tool for studying COVID-19 pathogenesis because the selective expression of hACE2 can shed light on the roles of different tissues in SARS-CoV-2-associated complications. Obviously, it can also be used for preclinical trials of antiviral drugs and new vaccines.

Introduction. The drugs affecting a mitochondrial dysfunction, oxidative stresses, apoptosis and inflammation of the vascular wall, have a high potential for the prevention and treatment of atherosclerotic lesions. In this regard, the use of EPOR/CD131 heteroreceptor agonists which have a similar spectrum of pharmacological effects, is one of the promising strategies in the treatment of cardiovascular diseases.Materials and Methods. The study was carried out on 68 C57Bl/6J male mice. Atherosclerosis was simulated in transgenic animals with an endotheliospecific knockdown of the Polg gene by simulating a balloon injury and keeping on a Western diet. Then, the studied drugs were injected once every 3 days at the dose of 20 μg/kg for 27 days. On the 28-th day, the animals were euthanized and the area of atherosclerotic plaques was assessed. The gene expression associated with the processes of inflammation, antioxidant protection, apoptosis, and angiogenesis was also determined in the aortic tissues. In addition, the endothelium protective effect of peptides on primary cultures of endothelial cells of wild and transgenic Polg-D257A mice was studied.Results. No statistically significant effect of drugs on the area of lipid infiltration have been found. However, the studied peptides have significantly reduced the expression of proinflammatory genes (iNos, Icam1, Vcam1, Sele, Il6, Tnfa), the genes associated with angiogenesis (Vegfa, Kdr, and Hif1a), the expression of proapoptic factors; they decreased the Bax/Bcl-2 ratio by more than 1.5 times. In addition, when supplemented with H2 O2  in vitro, peptides dose-dependently increased endothelial cell survival.Conclusion. The erythropoietin-based peptides can be used to improve the functional state of the vascular wall against the background of atherosclerotic lesions and have a depressing effect on pathobiological processes associated with a mitochondrial dysfunction. In addition, the studied peptides have a significant endothelial protective effect in the induction of oxidative stress in vitro.

Citation: Kalmykov VA, Kusov PA, Yablonskaia MI, Korshunov EN, Korshunova DS, Kubekina MV, Silaeva YYu, Deykin AV, Lukyanov NE (2018) New personalized genetic mouse model of Lesch-Nyhan syndrome for pharmacology and gene therapy. AbstractIntroduction: Lesch-Nyhan syndrome is a clinical and laboratory disorder caused by X-linked disruption of the purine metabolism. The deletion in the HPRT1 gene leads to the disappearance of valine in the eighth position of the protein amino acid sequence. The disease occurs in males and is accompanied by an excess of uric acid, urate nephropathy and neurologic impairment. Objective of the Study:Generation of the new personalized genetic mouse model of Lesch-Nyhan syndrome for preclinical study of new approaches to the pharmacological and gene therapy Materials and Methods: For genomic editing, the sequence was synthesized the sequence of the matrix GACCG-GTCCCGTCATGCCGACACGCAGTCCCAGCGTGGTGAGCCAAGGGGACTCCAGCAGAGCCCCACAG was synthesized. For the cultivation of viable mouse embryos after microinjection, KSOM media was used. Amplification and sequencing was performed by the standard methods. Results:A boy with not previously described hemizygous variant in the HPRT1 gene, was observed in our clinic. The mutation was the deletion of 8Val in the first exon of the HPRT1 gene. To introduce this mutation, we used the CRIS-PR-Cas9 genomic editing system. The genetic construct for microinjections included a mixture of the vector for the expression of Cas9 and sgRNA (px330), as well as the matrix for homologous recombination (ssODN), in a ratio of 1 part Cas9 to 3 parts of the ssODN matrix. Four of the 12 obtained animals were mosaic transgenes. One of 4 mice mated with a male from the hybrid strain CBA x C57BL/6, and descendants of F 2 have already been received from this mating. Discussion:During the creation of HPRT1 genetically modified mice, we encountered certain difficulties. First, from 615 transplanted embryos, only 12 were able to complete full embryonic development. 9 recipients we observed abortions in the later stages. These data may indicate possible violations of embryonic development in animals carrying a mutant copy of the HPRT1 gene. Conclusion:In the current study, we present the results of the generation of a genetically modified mouse strain carrying a deletion in the HPRT1 gene. These mice can be effectively used for the preclinical testing of new drugs aimed at the treatment of Lesch-Nyhan syndrome.

No abstract

No abstract