• The recent discovery of mutations in the uromodulin gene (UMOD) in patients with medullary cystic kidney disease type 2 (MCKD2), familial juvenile hyperuricemic nephropathy (FJHN), and glomerulocystic kidney disease (GCKD) provides the opportunity for a revision of pathogenic aspects and puts forth the basis for a renewed classification. This review focuses on clinical, pathological, and cell biology advances in UMOD-related pathological states, including a review of the associated clinical conditions described to date in the literature. Overall, 31 UMOD mutations associated with MCKD2 and FJHN (205 patients) and 1 mutation associated with GCKD (3 patients) have been described, with a cluster at exons 4 and 5. Most are missense mutations causing a cysteine change in uromodulin sequence. No differences in clinical symptoms between carriers of cysteine versus polar residue changes have been observed; clinical phenotypes invariably are linked to classic MCKD2/FJHN. A common motif among all reports is that many overlapping symptoms between MCKD2 and FJHN are present, and a separation between these 2 entities seems unwarranted or redundant. Cell experiments with mutant variants indicated a delay in intracellular maturation and export dynamics, with consequent uromodulin storage within the endoplasmic reticulum (ER). Patchy uromodulin deposits in tubule cells were found by means of immunohistochemistry, and electron microscopy showed dense fibrillar material in the ER. Mass spectrometry showed only unmodified uromodulin in urine of patients with UMOD mutations. Lack of uromodulin function(s) is associated with impairments in tubular function, particularly the urine-concentrating process, determining water depletion and hyperuricemia. Intracellular uromodulin trapping within the ER probably has a major role in determining tubulointerstitial fibrosis and renal failure. We propose the definition of uromodulin storage diseases for conditions with proven UMOD mutations. Am J Kidney Dis 44:987-999.

No abstract

SUMMARY Immune dysregulation, polyendocrinopathy and enteropathy with X‐linked inheritance (IPEX) is a serious disease arising from mutations in FOXP3. This gene codifies for a transcription factor whose dysfunction results in hyperactivation of T cells. It is not clear, however, why an intermediate phenotype is not seen in heterozygous females, who are completely healthy. In order to address this question, we investigated X‐chromosome inactivation in peripheral blood lymphocytes from a heterozygous female with a child affected by IPEX. No preferential inactivation was shown in freshly sorted CD4+, CD8+, CD19+ cells or in IL‐2 cultured CD4 and CD8 T cells, indicating that peripheral blood lymphocytes in these women are randomly selected. Moreover, only one single FOXP3 transcript was expressed by CD4 T cell clones analysed by RT‐PCR, confirming that this gene is subject to X‐ inactivation. We hypothesize that hyper‐activation of T cell in carriers of FOXP3 mutations is regulated by the presence of normal regulatory T cells.

The promoter of the murine c-Ki-ras proto-oncogene contains a critical homopurine-homopyrimidine sequence which is recognized by a protein factor and is a potential site for triplex-forming oligonucleotides (TFOs). The TFOs designed to bind this critical c-Ki-ras target have either an AG or a GT sequence motif. Of the two types, the first is found to form triplexes with extraordinarily high stability. For instance, both d(AGGGAGGGAGGAAGGGAGGG) (20AG) and d(GGGAGGGAGGGAAGGAGGGAGGGAGGGAGC) (30AG) are able to bind the c-Ki-ras target at 65 degrees C and to resist a polyacrylamide gel temperature of 55 degrees C. By contrast, the triplex formed by d(TGGGTGGGTGGTTGGGTGGG) (20GT) is largely dissociated at a gel temperature of 55 degrees C. The affinity constants of the TFOs at 37 degrees C, 50 mM Tris-HCl, pH 7.4, 50 mM NaCl, 5 mM MgCl2 (standard buffer) were determined through band-shift experiments and found to be respectively 1.0 x 10(6), 4.0 x 10(6), and 2.5 x 10(7) M-1 for 20GT, 30AG, and 20AG. The AG-triplexes exhibit in standard buffer monophasic melting profiles (Tm approximately 75 degrees C) and circular dichoroism spectra showing the typical negative ellipticity at 212 nm, which is a hallmark for triplex DNA. The rate at which the TFOs bind to the c-Ki-ras target at 37 degrees C was examined under pseudo-first-order conditions. When the TFOs are in excess over the target and in the micromolar concentration range, the kinetics of triplex formation are slow, characterized by association half-lives of about 1 h. The ability of the TFOs to act as artificial transcription repressors was examined in a cellular system employing transient transfection experiments. Cultured NIH 3T3 fibroblast cells were cotransfected with a DNA mixture composed by a TFO and plasmid pKRS-413 containing the chloramphenicol acetyltransferase (CAT) gene driven by the c-Ki-ras promoter. It was found that the CAT activity is specifically inhibited by the TFOs in a dose-dependent manner. As expected, stronger CAT repression is obtained with 20AG, the oligonucleotide which forms the more stable triplex. These data suggest that (A,G)-oligonucleotides may provide a valuable means for the selective repression of the c-Ki-ras gene expression.

We investigated the polymorphisms of the promoter region of the MBL2 gene, which codifies for the Mannose-binding protein (MBP). The study population included 90 children with vertically acquired HIV-infection, further divided on the basis of the disease rate, 27 HIV exposed-uninfected children, and 74 healthy control subjects matched for ethnic origin to evaluate the MBP involvement in the risk of HIV-1 infection and to assess the role of the MBP promoter in AIDS progression. A region of 380 bp in the promoter of the MBL2 gene was analysed by PCR and direct sequencing of both DNA strands. We found that the polymorphism at position −550 influences the risk of HIV-infection and AIDS progression. Also a 6 bp deletion at position −328 was correlated with HIV-1 infection. This study indicates that the promoter of the MBL2 gene influences vertical transmission of HIV and the course of perinatal infection. Genes and Immunity (2000) 1, 346-348.