African and Asian populations of Fusarium spp. (Gibberella fujikuroi species complex) associated with Bakanae of rice (Oryzae sativa L.) were isolated from seeds and characterized with respect to ecology, phylogenetics, pathogenicity and mycotoxin production. Independent of the origin, Fusarium spp. were detected in the different rice seed samples with infection rate ranges that varied from 0.25% to 9%. Four Fusaria (F. andiyazi, F. fujikuroi, F. proliferatum and F. verticillioides) were found associated with Bakanae of rice. While three of the Fusaria were found in both African and Asian seed samples, F. fujikuroi was only detected in seed samples from Asia. Phylogenetic studies showed a broad genetic variation among the strains that were distributed into four different genetic clades. Pathogenicity tests showed that all strains reduced seed germination and possessed varying ability to cause symptoms of Bakanae on rice, some species (i.e. F. fujikuroi) being more pathogenic than others. The ability to produce fumonisins (FB(1) and FB(2)) and gibberellin A3 in vitro also differed according to the Fusarium species. While fumonisins were produced by most of the strains of F. verticillioides and F. proliferatum, gibberellin A3 was only produced by F. fujikuroi. Neither fumonisin nor gibberellin was synthesized by most of the strains of F. andiyazi. These findings provide new information on the variation within the G. fujikuroi species complex associated with rice seed and Bakanae disease.

Biochemical and molecular characterization ofFifty-one Bacillus isolates were characterized by fatty acid methyl ester (FAME) analysis; universal primer polymerase chain reaction (UP-PCR) fingerprinting; production of secondary metabolites and antagonistic activity against Xanthomonas campestris pv. campestris (causal agent of black rot in cabbage) in vitro and in vivo . Based on FAME analysis and /or PCR fingerprinting, the isolates were clustered into three different groups, named as Bacillus amyloliquefaciens , B . subtilis and B . pumilus . Seed treatment with Bacillus spp. generally reduced germination of seeds and incidence of black rot, but no relationship was found between the results of in vitro and in vivo experiments. The B . amyloliquefaciens group contained isolates that were generally the most effective at reducing attack of black rot in vivo . The metabolic profiles of these isolates suggested that they produced surfactin, iturin, bacillomycine and /or azalomycin F. Isolates belonging to the B . subtilis group were mostly able to synthesize surfactin and arthrobactin. Surfactin, amphomycin, arthrobactin and valinomycin were generally found in culture extracts of isolates belonging to the B . pumilus group. No effect on growth of the pathogen was detected when the activity of filtered culture extracts and selected metabolites produced by the three different Bacillus species was tested in vitro against X . c . pv. campestris . However, inhibition was seen when bacterial liquid cultures were used. When the ability to colonize cabbage endophytically was examined for seven selected isolates with different antagonistic potential against black rot, it was found that the ability was related to the species and not to the antagonistic activity of the isolates.

Recent developments in genomics have opened up for newer opportunities to study the diversity and classification of fungi. The genus Fusarium contains many plant pathogens that attack diverse agricultural crops. Fusarium spp. are not only pathogenic to plants but are also known as toxin producers that negatively affect animal and human health. The identification of Fusarium species still remains one of the most critical issues in fungal taxonomy, given that the number of species recognized in the genus has been constantly changing in the last century due to the different taxonomic systems. This review focuses of various molecular-based techniques employed to study the diversity of Fusarium species causing diseases in major food crops. An introduction of fusarial diseases and their mycotoxins and molecular-marker-based methods for detection introduce the concept of marker application. Various well-known molecular techniques such as random amplified polymorphic DNA, amplification fragment length polymorphism, etc. to more modern ones such as DNA microarrays, DNA barcoding, and pyrosequencing and their application form the core of the review. Target regions in the genome which can be potential candidates for generation of probes and their use in phylogeny of Fusarium spp. are also presented. The concluding part emphasizes the value of molecular markers for assessing genetic variability and reveals that molecular tools are indispensable for providing information not only of one Fusarium species but on whole fungal community. This will be of extreme value for diagnosticians and researchers concerned with fungal biology, ecology, and genetics.

From 2008 to 2010, leaf spot symptoms were observed on tomato (Solanum lycopersicum Mill.) plants growing in the northern, central and southern highland regions of Tanzania. Symptoms were dark, circular to irregular, water-soaked spots surrounded by chlorotic halos. A total of 136 yellow-pigmented, gram-negative bacteria were isolated from 117 symptomatic plants on nutrient agar. Loopfuls from 24-h-old bacterial cultures were suspended in 500 μl of sterile distilled water and 50 μl of the suspensions were printed on strips of 3MM Whatman chromatography paper. Isolates belonging to the genus Xanthomonas were subsequently identified by PCR amplification of a 402-bp fragment of the Xanthan synthesis pathway gene, gumD (primers: X-gumD-fw 5′GGCCGCGAGTTCTACATGTTCAA and X-gumD-rv 5′CACGATGATGCGGATATCCAGCCACAA). Thirty of the 136 isolates reacted positively in gumD PCR. Pathogenicity of the 30 gumD-positive isolates was confirmed by spraying cell suspensions containing 108 CFU/ml (OD600 = 0.01) of each isolate on four 14-day-old tomato seedlings (cv. Tanya) and sweet pepper (Capsicum annuum L.) cv. Early-Calwonder in a growth chamber at 28 ± 2°C and maintained under humid conditions. Plants sprayed with X. euvesicatoria, X. vesicatoria, X. perforans, and X. gardneri (2) strains NCPPB 2968, 422, 4321, and 881, respectively, served as positive controls. Plants sprayed with sterile distilled water alone served as negative control. The 30 tested isolates were pathogenic on tomato and pepper within 7 to 14 days and induced similar symptoms as those observed on tomato field plants and plants sprayed with reference strains of xanthomonads. Symptoms were not observed on negative control plants. Yellow-pigmented colonies were reisolated from symptomatic plants and their identity confirmed with GumD-PCR. Based on partial sequencing of the fyuA gene using primers developed by Young et al. (4), all 30 isolates were subsequently grouped into five clusters of the genus Xanthomonas. With recent taxonomy of Xanthomonas (2,4), four of these clusters displayed more than 99% sequence identity to known species of Xanthomonas: X. arboricola EU498923 (18 isolates); X. perforans EU498944 (6 isolates), X. vesicatoria EU498876 (2 isolates), and X. euvesicatoria EU498912 (1 isolate). The remaining three isolates formed a fifth cluster displaying less than 94% sequence identity to any known sequence of fyuA (93% matching strains: X. axonopodis EU498914; X. melonis EU498918, and X. cucurbitae EU498891). Representative sequences for each of the five clusters of bacterial leaf spot (BLS) strains mentioned have been deposited in GenBank (Nos. JQ418487, JQ418488, JQ418489, JQ418490, and JQ418491, respectively). BLS of tomato plants and its economic impact has been reported in Tanzania (3). Different BLS causal agents have recently been reported from the Southwest Indian Ocean Region (1), however, corresponding information for Tanzania has been lacking. On the basis of fyuA sequences, this study reports four genotypes of BLS causal agents corresponding to known species of Xanthomonas. In addition, Xanthomonas isolates with a fyuA genotype not previously assigned to any known species has been identified as part of the BLS pathosystem in Tanzania. References: (1) A. A. Hamza et al. Plant Dis. 94:993, 2010. (2) B. J. Jones et al. Syst. Appl. Microbiol. 27:755, 2004. (3) K. C. Shenge et al. Afr. J. Biotechnol. 6:15, 2007. (4) J. M. Young et al. Syst. Appl. Microbiol. 31:366, 2008.

Bacterial leaf spot (BLS) caused by seed-borne xanthomonads is a serious disease of tomato (Solanum lycopersicum L.), causing significant losses in both yield and quality. To identify more effective control measures, we evaluated crude extracts from 84 plant species in in vitro and in planta assays for antibacterial activity against BLS of tomato. In the in vitro assays, 20.2 % of the tested plant extracts totally inhibited growth of bacteria when seed washings from treated seeds were plated on nutrient agar medium. In the in planta assays, 17.8 % of the tested plant extracts reduced BLS incidence by 100 % in tomato seedlings. The most effective seed treatments were obtained with extracts from Aloe vera, Betula pendula, Coffea arabica, Glycyrrhiza uralensis, Juniperus communis, Ocimum basilicum, Quercus robur, Rheum palmatum, Rosmarinus officinalis, Ruta graveolens, Sinapis alba, Yucca schidigera and Salvia officinalis. Seed treatment of tomato with these extracts completely inhibited Xanthomonas perforans in both in vitro and in planta assays. Extracts from A. vera, C. arabica and Y. schidigera were tested three times using tomato seeds of cultivars Tanya, Cal-J and Moneymaker in Tanzania. Treatment of tomato seeds with these extracts had a positive effect on the number of normal seeds and had no effect on seedling vigor, height and weight. These results indicate that plant extracts from A. vera, C. arabica and Y. schidigera are potential candidates for seed treatment against seed-borne xanthomonads of tomato in Tanzania.