No abstract

The non-lipid-dependent species Malassezia pachydermatis is frequently isolated from animals. We analyzed the DNA sequences of the intergenic spacer (IGS) 1 region, which is the most variable region in the rRNA gene, of 43 M. pachydermatis strains obtained from dogs or cats. The lengths of the IGS 1 regions ranged from 552 to 898 bp and, based on the nucleotide sequence, these IGS 1 regions were divided into three major groups with 10 subtypes. Group 1 (552-601 bp long) was characterized by the short sequence repeat (CAGCA)n and had four to 14 repeats, and Group 3 (749-898 bp long), which included the neotype strain of M. pachydermatis, was characterized by the sequence (CAGCATAACATAACACACAACA)n in the IGS1 region. Group 2 possessed partial sequences of both Groups 1 and 3. Each group shared only 41.7-55.4% similarity in the IGS1 region with the other groups. The internal transcribed spacer (ITS) region and D1/D2 26S rDNA in the rRNA gene were also sequenced for representative strains in each IGS group. The groups were distinguished by both ITS (698-712 bp long including 5.8S rDNA) and D1/D2 26S rDNA (624 bp long) sequences with sequence similarities of 91.7-96.0% and 99.7-99.0%, respectively. Our results indicate that the sequence of the IGS region of M. pachydermatis has a remarkable intraspecies diversity, compared with ITS or D1/D2 26S rDNA, and that multiple genotypic strains of M. pachydermatis colonize animal skin.

, Vladislav Raclavsky aAims. Limited aeration has been demonstrated to cause slowdown in proliferation and delayed budding, resulting eventually in a unique unbudded G2-arrest in the obligate aerobic pathogenic yeast Cryptococcus neoformans. Also, the ability to adapt to decreased oxygen levels during pathogenesis has been identified as a virulence factor in C. neoformans. The aim of this study was to identify and characterize genes that are necessary for the proliferation slowdown and G2-arrest caused by limited aeration. Methods. Random mutants were prepared and screened for lack of typical slowdown of proliferation under limited aeration. The CNAG_00156.2 gene coding for a zinc-finger transcription factor was identified in mutants showing most distinctive phenotype. Targeted deletion strain and reconstituted strain were prepared to characterize and confirm the gene functions. This gene was also identified in a parallel studies as homologous both to calcineurin responsive (Crz1) and PKC1-dependent (SP1-like) transcription factors. Results. We have confirmed the role of the cryptococcal homologue of CRZ1/SP1-like transcription factor in cell integrity, and newly demonstrated its role in slowdown of proliferation and survival under reduced aeration, in biofilm formation and in susceptibility to fluconazole.Conclusions. Our data demonstrate a tight molecular link between slowdown of proliferation during hypoxic adaptation and maintenance of cell integrity in C. neoformans and present a new role for the CRZ1 family of transcription factors in fungi. The exact positioning of this protein in cryptococcal signalling cascades remains to be clarified.

A taxonomic revision of Puccinia species causing rust diseases on sugarcane was conducted to clarify their morphological characteristics. Specimens including previously reported species, Puccinia melanocephala, P, kuehnii and Puccinia sp. sensu Muta, 1987, were collected in Japan and the Philippines and borrowed from various herbaria worldwide. Morphological characteristics of these specimens were examined under light and scanning electron microscopes. Comparative morphological studies of the specimens showed that rust fungi infecting sugarcane could be classified into two species, Puccinia melanocephala and P. kuehnii. Puccinia sp. sensu Muta was morphologically identical with P. kuehnii. Results of this study corroborate previous phylogenetic analysis results of D 1/D2 regions of LSU rDNA gene.

The cell cycle pattern of the pathogenic basidiomycetous yeast Cryptococcus neoformans differs from that of the ascomycetous budding yeast Saccharomyces cerevisiae. To clarify the cell cycle control mechanisms at the molecular level, homologues of cell cycle control genes in C. neoformans were cloned and analyzed. Here, we report on the cloning and characterization of genes coding for CDK1 cyclin homologues, in particular, the C. neoformans G1 cyclin. We have identified three putative CDK1 cyclin homologues and two putative CDK5 (PHO85) cyclin homologues from the genome. Complementation tests in an S. cerevisiae G1 cyclin triple mutant confirmed that C. neoformans CLN1 is able to complement S. cerevisiae G1 cyclin deficiency, demonstrating that it is a G1 cyclin homologue. Interestingly, cells deleted of the single Cdk1-G1 cyclin were viable, demonstrating that this gene is not essential. However, it exhibited aberrant budding and cell division and a clear delay in the initiation of DNA synthesis as well as an extensive delay in budding. The fact that the mutant managed to traverse the G1 to M phase may be due to the activities of Pho85-related G1 cyclins. Also, that C. neoformans had only a single Cdk1-G1 cyclin highlighted the importance of keeping in order the commitment to the initiation of DNA synthesis first and then that of budding, as discussed.