Common bean web blight (WB), caused by the fungus Rhizoctonia solani (teleomorph Thanatephorus cucumeris), is among the endemic fungal diseases of major impact in north‐western Argentina (NWA). This study aimed to analyse the genetic and pathogenic diversity of R. solani in Salta, NWA, where 97 isolates were recovered from commercial bean cultivars and wild beans showing WB symptoms in a major bean production area. The isolates were characterized on the basis of specific primers, rDNA‐ITS sequences and morphological characteristics. All the isolates were identified as R. solani AG 2‐2WB, and they exhibited considerable intragroup variation. The phylogenetic tree generated with the ITS sequences confirmed the isolates identification. Aggressiveness of the isolates towards bean seedlings was assessed in the greenhouse. A great variability in virulence was observed among the isolates analysed. On the basis of the disease reaction on foliar tissues, the isolates were grouped into three virulence categories as follows: weakly virulent (30%), moderately virulent (38%) and highly virulent (32%). However, no correlation between virulence and geographical origin was detected. The information generated in this study provides initial data on the population variability of the WB pathogen in north‐western Argentina and represents a valuable contribution to regional breeding programmes aimed to obtain cultivars with durable resistance.

In August 2010, lesions similar to those reported for target spot were observed on Nicotiana tabacum L. plants produced in float systems in Cerrillos, Salta, Argentina. Tobacco leaves with characteristic lesions were collected from different locations in Cerrillos, Salta. Symptoms ranged from small (2 to 3 mm), water-soaked spots to larger (2 to 3 cm), necrotic lesions that had a pattern of concentric rings, tears in the centers, and margins that often resulted in a shot-hole appearance. Isolation of the causal agent was made on potato dextrose agar (PDA) acidified to pH 5 with 10% lactic acid and incubated at 25 ± 2°C in darkness for 2 to 3 days. Hyphal tips were transferred to a new medium and the cultures were examined for morphological characters microscopically (3). Eight isolates were obtained. The rapid nuclear-staining procedure using acridine orange (3) was used to determine the number of nuclei in hyphal cells. Multinucleate hyphae were observed, with 4 to 9 nuclei per cell. Molecular characterization was conducted by examining the internal transcribed spacer (ITS) region from all of the isolates of the pathogen identified as Rhizoctonia solani based on morphological characteristics (1). Fragments amplified using primers ITS1 (5′TCCGTAGGTGAACCTGCGG3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′) (4) were sequenced and compared with R. solani anastomosis group (AG) sequences available in the NCBI GenBank database. Sequence comparison identified this new isolate as R. solani anastomosis group AG 2-1. Previous isolates of target spot were identified as AG 3 (2). The isolates that were studied were deposited in the “Laboratorio de Sanidad Vegetal” INTA-EEA-Salta Microbial Collection as Rs59c, Rs59b, Rs59, Rs66, Rs67, Rs68, Rs69, and Rs70. The ITS nucleotide sequence of isolate Rs59 has been assigned the GenBank Accession No. JF792354. Pathogenicity tests for each isolate were performed using tobacco plants grown for 8 weeks at 25 ± 2°C with a 12-h photoperiod. Ten plants were inoculated by depositing PDA plugs (0.2 cm) colonized with R. solani onto leaves; plants inoculated with the pure PDA plug without pathogen served as controls. The plants were placed in a 25 ± 2°C growth chamber and misted and covered with polyethylene bags that were removed after 2 days when plants were moved to a glasshouse. After 48 h, symptoms began as small (1 to 2 mm), circular, water-soaked spots, lesions enlarged rapidly, and often developed a pattern of concentric rings of 1 to 2 cm. After 8 days, all inoculated plants showed typical disease symptoms. Morphological characteristics of the pathogen reisolated from symptomatic plants were consistent with R. solani. Control plants remained healthy. These results correspond to the first reports of the disease in the country. Compared to other areas in the world, target spot symptoms were only observed in tobacco plants produced in float systems and were not observed in the field. The prevalence of the disease in Salta, Argentina was 7%. To our knowledge, this is the first report of R. solani AG2.1 causing target spot of tobacco. References: (1) M. Sharon et al. Mycoscience 49:93, 2008. (2) H. Shew and T. Melton. Plant Dis. 79:6, 1995. (3) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991. (4) T. J. White et al. Page 282 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

The objective of this study was to perform the molecular and pathogenic characterization of Rhizoctonia solani in bean seed and soil samples from fields with root rot symptoms in northwestern Argentina. Fifty-two Rhizoctonia spp. isolates were collected in ten naturally infested bean fields and characterized by morphological traits, DNA sequencing, and pathogenicity. The mycelium color, the pattern of sclerotia formation, and the number of nuclei per hyphal cell were determined for each isolate. According to the variability in the rDNA-ITS region, isolates were identified as R. solani (85%), Waitea circinata var. zeae (Rhizoctonia zeae) (2%) and Rhizoctonia spp. (13%). Most isolates of R. solani (92%) were found to belong to the anastomosis group (AG) AG 4, including seven AG 4 HG-I and nine AG 4 HG-III isolates. AGs obtained from soil samples were more variable than those obtained from seed samples. Molecular identification of the isolates was in agreement with their morphological characterization. In addition, aggressiveness of the isolates towards bean seedlings was assessed in the greenhouse. Four virulence categories were defined according to the disease reaction on root and foliar tissues, which showed great variability in virulence among the isolates. Our results suggest that both seed and soil-borne inoculum may play a significant role in pathogen dispersal in the region. This is the first study on Rhizoctonia species and AGs in bean seed and soil in this region and it may contribute towards an efficient control strategy for bean diseases caused by Rhizoctonia species.

The common bean (Phaseolus vulgaris L.) is the most important grain legume in the human diet, mainly in Africa and Latin America. Argentina is one of the five major producers of the common bean in the world, and the main cultivation areas are concentrated in the northwestern provinces of this country. Crop production of the common bean is often affected by biotic factors like some endemic fungal diseases, which exert a major economic impact on the region. The most important fungal diseases affecting the common bean in Argentina are white mold caused by Sclerotinia sclerotiorum, angular leaf spot caused by Pseudocercospora griseola, web blight and root rot caused by Rhizoctonia solani, which can cause production losses of up to 100% in the region. At the present, the most effective strategy for controlling these diseases is the use of genetic resistance. In this sense, population study and characterization of fungal pathogens are essential for developing cultivars with durable resistance. In this review we report diversity studies carried out on these three fungal pathogens affecting the common bean in northwestern Argentina, analyzing more than 200 isolates by means of molecular, morphological and pathogenic approaches. Also, the screening of physiological resistance in several common bean commercial lines and wild native germplasm is reviewed. This review contributes to the development of sustainable management strategies and cultural practices in bean production aimed to minimize yield losses due to fungal diseases in the common bean.