Rationale:Hypochondroplasia (HCH) is the mildest form of chondrodysplasia characterized by disproportionate short stature, short extremities, and variable lumbar lordosis. It is caused by mutations in fibroblast growth factor receptor 3 (FGFR3) gene. Up to date, at least thirty mutations of FGFR3 gene have been found to be related to HCH. However, mutational screening of the FGFR3 gene is still far from completeness. Identification of more mutations is particularly important in diagnosis of HCH and will gain more insights into the molecular basis for the pathogenesis of HCH.Patient concerns:A large Chinese family consisting of 53 affected individuals with HCH phenotypes was examined.Diagnoses:A novel missense mutation, c.1052C>T, in FGFR3 gene was identified in a large Chinese family with HCH. On the basis of this finding and clinical manifestations, the final diagnosis of HCH was made.Interventions:Next-generation sequencing (NGS) of DNA samples was performed to detect the mutation in the chondrodysplasia-related genes on the proband and her parents, which was confirmed by Sanger sequencing in the proband and most of other living affected family members.Outcomes:A novel missense mutation, c.1052C>T, in the extracellular, ligand-binding domain of FGFR3 was identified in a large Chinese family with HCH. This heterozygous mutation results in substitution of serine for phenylalanine at amino acid 351 (p.S351F) and co-segregates with the phenotype in this family. Molecular docking analysis reveals that this unique FGFR3 mutation results in an enhancement of ligand-binding affinity between FGFR3 and its main ligand, fibroblast growth factor 9.Lessons:This novel mutation is the first mutation displaying an increase in ligand-binding affinity, therefore it may serve as a model to investigate ligand-dependent activity of FGF-FGFR complex. Our data also expanded the mutation spectrum of FGFR3 gene and facilitated clinic diagnosis and genetic counseling for this family with HCH.

Introduction: Long QT syndrome (LQTS) is electrocardiographically characterized by a prolonged QT interval and manifests predisposition to life-threatening arrhythmia which often leads to sudden cardiac death. Type 2 LQTS (LQT2) is the second most common subtype of LQTS and caused by mutations in KCNH2 gene. Up to date, >900 mutations have been reported to be related to LQT2. However, mutational screening of the KCNH2 gene is still far from completeness. Identification of KCNH2 mutations is particularly important in diagnosis of LQT2 and will gain more insights into the molecular basis for the pathogenesis of LQT2.Patient concerns: A Chinese Han family with LQTS phenotypes was examined.Diagnosis: A novel deletion-frameshift mutation, c.381_408delCAATTTCGAGGTGGTGATGGAGAAGGAC, in exon 3 of KCNH2 gene was identified in a Chinese family with LQTS. On the basis of this finding and clinical manifestations, the final diagnosis of LQT2 was made.Interventions: Next-generation sequencing (NGS) of DNA samples was performed to detect the mutation in the LQTS-related genes on the proband and her mother, which was confirmed by Sanger sequencing. The proband was then implanted with an implantable cardioverter defibrillator and prescribed metoprolol 47.5 mg per day.Outcomes: This novel heterozygous mutation results in a frameshift mutation after the 128 th residue (Asparagine), which replaced the original 1031 amino acids with 27 novel amino acids (p.N128fsX156). Conclusion:This novel mutation presumably resulted in a frameshift mutation, p.N128fsX156. Our data expanded the mutation spectrum of KCNH2 gene and facilitated clinic diagnosis and genetic counseling for this family with LQTS.Abbreviations: ECG = electrocardiogram, hERG = human ether a go-go-related K + channel protein, ICD = implantable cardioverter defibrillator, KCNH2 = potassium voltage-gated channel subfamily H member 2, LQT2 = type 2 LQTS, LQTS = long QT syndrome, NGS = next-generation sequencing, QTc = rate-corrected QT.