Source/Description: The polymorphic (TG)n repeat begins at the 10313 base pair of the human int-2 proto-oncogene locus on chromosome 1 1q13 (1). The polymorphism can be typed using the polymerase chain reaction (PCR) as described previously (2). The predicted length of the amplified sequence was 167 bp. Primer Sequences: TTTCTGGGTGTGTCTGAAT (TG strand); ACACAGTTGCTCTAAAGGGT (AC strand).
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.