Pituitary neuroendocrine tumors (PitNETs) are non-metastatic neoplasms of the pituitary, which overproduce hormones leading to systemic disorders, or tumor mass effects causing headaches, vertigo or visual impairment. Recently, PitNETs have been investigated in large scale (exome and genome) molecular analyses (transcriptome microarrays and sequencing), to uncover novel markers. We performed a literature analysis on these studies to summarize the research data and extrapolate overlapping gene candidates, biomarkers, and molecular mechanisms. We observed a tendency in samples with driver mutations (GNAS, USP8) to have a smaller overall mutational rate, suggesting driver-promoted tumorigenesis, potentially changing transcriptome profiles in tumors. However, direct links from drivers to signaling pathways altered in PitNETs (Notch, Wnt, TGF-β, and cell cycle regulators) require further investigation. Modern technologies have also identified circulating nucleic acids, and pinpointed these as novel PitNET markers, i.e., miR-143-3p, miR-16-5p, miR-145-5p, and let-7g-5p, therefore these molecules must be investigated in the future translational studies. Overall, large-scale molecular studies have provided key insight into the molecular mechanisms behind PitNET pathogenesis, highlighting previously reported molecular markers, bringing new candidates into the research field, and reapplying traditional perspectives to newly discovered molecular mechanisms.

Objective: Circulating free DNA (cfDNA) in general and circulating tumor DNA (ctDNA) in particular is becoming an increasingly used form of liquid biopsy biomarkers. In this study, we are investigating the ability to detect ctDNA from the plasma of pituitary adenoma (PA) patients.Design: Tumor tissue samples were obtained from planed PA resections, before which blood plasma samples were taken. Somatic variants found in PA tissue samples were evaluated in related cfDNA, isolated from plasma samples.Methods: Sanger sequencing, as well as previously obtained whole-exome sequencing data, were used to evaluate somatic variants composition in tumor tissue samples. cfDNA was isolated from the same PA patients and competitive allele-specific TaqMan PCR and amplicon-based next-generation sequencing (NGS) approach were used for targeted detection of variants found in corresponding tumor tissue samples.Results: Using NGS-based analysis, we detected five out of 17 somatic variants in 40 to 60% of total reads, three variants in 0.50–5.00% of total read count, including GNAS c.601C>T, which was detected using ultra-deep NGS (1.78 million X) in 0.77% of amplicons reads. Nine variants were not detected. We also detected We were not able to detect variant found in PA tissue in cfDNA using cast-PCR, indicating that the portion of variant-containing ctDNA in total isolated cfDNA is too small to be detected with this method.Conclusions: For the first time, we demonstrate the possibility to detect somatic variants of PA in cfDNA isolated from patients' blood plasma. Whether the source of variant detected in cfDNA is PA should be further tested.

No abstract

ObjectiveCirculating miRNAs are found in bodily fluids including plasma and can serve as biomarkers for diseases. The aim of this study was to provide the first insight into the landscape of circulating miRNAs in close proximity to the adrenocorticotropic hormone (ACTH) secreting PitNET. To achieve this objective next-generation sequencing of miRNAs in plasma from bilateral inferior petrosal sinus sampling (BIPSS) - a gold standard in diagnosing ACTH-secreting PitNETs was carried out and selected miRNA candidates were further tested by RT-qPCR in independent patient cohorts.MethodsSinistral (left) and dextral (right) BIPSS blood samples of the patient were collected in three time points: before the administration of corticotropin-releasing hormone, 5 and 15 minutes after stimulation. In differential expression analysis, sinistral plasma was compared with dextral. The selected miRNA candidates were tested in plasma by RT-qPCR in two patient groups: 1) in five ACTH secreting PitNET patients with plasma samples taken before and 24 hours after surgery, 2) in 12 ACTH secreting PitNET patients vs. 9 non-functioning PitNET patients.ResultsBIPSS concluded that the highest amount of ACTH was released in the sinistral side at the 5th minute mark indicating a presence of a tumor. The highest amount of differentially expressed miRNAs was observed 5 minutes after stimulation (20 upregulated, 14 downregulated). At the 5th minute mark in sinistral plasma, two miRNAs were identified: hsa-miR-7-5p and hsa-miR-375-3p that were highly upregulated compared to other BIPSS samples and peripheral plasma samples. Further testing by qPCR revealed significant reduction of miR-7-5p in plasma 24 hours after surgery and upregulation in plasma of ACTH secreting PitNET patients compared to non-functioning PitNET patients (P =0.0013).ConclusionsBy stimulating the ACTH secreting PitNET with CRH a rapid increase of two miRNAs (hsa-mir-7-5p, hsa-mir-375-3p) and ACTH can be observed in sinistral inferior petrosal (tumor side). A decrease of miR-7-5p in plasma after surgery and upregulation in plasma of ACTH secreting PitNET patients was discovered implying that further studies of this miRNA as diagnostic marker is needed.

Blackcurrants (Ribes nigrum) are among the most important commercial berry crops in Latvia and, together with redcurrants and gooseberries, have a long history of local cultivation and breeding (Zuļģe et al. 2018). So far at least 20 viruses were reported to infect Ribes plants (Špak et al. 2021). Blackcurrant-associated rhabdovirus (BCaRV) was previously identified in USA by high throughput sequencing (HTS) of blackcurrant germplasm accession introduced from Russia (isolate Veloy) and now serves as an exemplar isolate for BCaRV (Wu et al. 2018). Presence of BCaRV was also confirmed by RT-PCR in blackcurrant germplasm accession of cv. Burga from France during the same study by Wu et al. (2018). Currently Blackcurrant betanucleorhabdovirus is one of the nine species recognized by ICTV in genus Betanucleorhabdovirus of family Rhabdoviridae, but the impact of BCaRV on the host still remains unknown. Leaf tissue from twelve asymptomatic blackcurrant cv. Mara Eglite plants that negatively tested for blackcurrant reversion virus from Dobele, Latvia (56°36'31.9"N, 23°18'13.6"E) was collected on May 17, 2019 and used for HTS study of local Ribes resistance genes. Total RNA from the leaf tissue of sampled plants was isolated following a method described by Kalinowska et al. (2012) with minor modifications. Briefly, RNeasy Plant Mini Kit (QIAGEN) was used with RLC lysis buffer being supplemented with 2% PVP and 1% β-mercaptoethanol. Plant rRNA was subsequently removed by a RiboMinus Plant Kit for RNA-Seq (Thermo Fisher Scientific (TFS)) prior to cDNA library construction. HTS libraries were prepared using MGIEasy RNA Directional Library Prep Set for 16 reactions (MGI), following a protocol for 150 bp pair-end reads. According to the manufacturers guidelines libraries were pooled, circularized and cleaned before being subjected to sequencing on DNBSEQ-G400 (MGI) using PE150 flow cell (MGI). The sequencing run yielded a total of 393660492 150 bp long read pairs. Reads were assembled into transcripts using rnaSPAdes v 3.13.1 (Bushmanova et al. 2019) and a 14424 base long contig with an average coverage of 684x was found to be 99.5% identical (14358/14432 identities and 8 gaps in the pairwise alignment) to the previously reported first complete genome of BCaRV (MF543022.1) using EMBOSS Needle (Madeira et al., 2019). This contig representing the genome of BCaRV isolate Mara Eglite, onto which 66768 of the raw reads could be mapped, was subsequently deposited at European Nucleotide Archive under accession number OU015520. All of the twelve individual samples were also tested for the presence of BCaRV by RT-PCR, using Verso cDNA Synthesis Kit with random hexamer primers (TFS) for first strand cDNA synthesis followed by PCR with N protein nested primers BCaRV-N-F (5’ AGATGTGCTTCATCGATGGCTAGTTCTGCT 3’) and BCaRV-N-R (5’ TGCATTCCCACGGGTTAGGAATACATTGGTACT 3’) resulting in a 243 bp long fragment for six of the samples. RT-PCR products from six BCaRV positive samples were directly sequenced by Sanger-based method using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) with BCaRV-N-F and BCaRV-N-R primers. Acquired RT-PCR product sequences matched the corresponding region of BCaRV isolate Mara Eglite genome assembled from HTS data. In this report, we have documented the natural occurrence of BCaRV in Latvia, which makes it a second evidence on the presence of BCaRV in Europe.