T2DM can be triggered by two collaborating factors, namely genetics and the environment. This study aimed to identify genetic markers that can be used to detect the possibility of a person having T2D using the random amplified polymorphism DNA (RAPD) method. The study was carried out cross-sectional and involved 60 samples consisting of 30 positive T2D samples and 30 negative samples T2D. The primer used for PCR-RAPD was D20 (5'-ACCCGGTCAC-3’). The PCR-RAPD results were then analyzed using the scoring method and analyzed using the non-parametric Chi-Square test (cl: 95%). Among T2D, 576 bp band were confirmed to be markers in the patients.

Diabetes Mellitus is a condition where there is an increase in blood glucose levels which is characterized by impaired insulin production or the inability of target tissues to respond to insulin. The purpose of this study was to determine the characteristics of the NADH Dehydrogenase 1 gene in the family of Type 2 Diabetes Mellitus patients. The study used a descriptive exploratory method. The sample came from a family of 5 people with T2D in Sidoarjo. Mitochondrial Genotype Analysis using PCR-Primary Sequencing Forward 5'GAGCAGAACCCAACCTCCGAGCAG3 '(nt2826–2849) and Primary Rivers 5'GATTGTTTGGGCTACTGCTCG3' (nt3728 - 3749). Analysis of the 5 samples used obtained 2 samples that can be analyzed with a band length of 690 bp and 84 bp. Based on the results of primary research, the sample used is difficult to get good amplification results. Only one out of five samples can be amplified properly. The variation of the amplified ND1 gene is found at positions T3031C, G3143C, A3252G, C3303T, C3707T.

Diabetes mellitus is a metabolic disorder characterized by not produced insulin or disruption of insulin action. Diabetes mellitus was reported correlated with TCF7L2 gene mutation. This study aimed to analyze the TCF7L2 gene in families with type 2 diabetes. 5 samples were used in this study, the methods flow through DNA Isolation, PCR, and sequencing. Samples were amplified by the PCR technique using primers that were designed to detect the TCF7L2 gene, (F: 5'-GGCTTGATTGTTGATTATGGGC3' and R:5 'TCTGGCACTCAGAGAGT 3'). The amplification and sequencing resulted in 368 bp (located at 103631-103972 bp). We found a transition mutation at C103950T. The polymorphisms found may characteristic in this population because they are not found in other sequences. Keywords : Diabetes mellitus, TCF7L2 gene, mutation