Human beings are sometime expose to the same to predisposing factors of a given infectious disease, but the outcome in terms of disease manifestation differs greatly. This variation is mainly attributed to the genetic makeup of such individuals; this is because human genetic has long been associated with the variation in susceptibility to various infectious diseases, which is termed as genetic resistance. Therefore the aim of this paper was to review the state of knowledge on genetic resistance associated with malaria infection. Genetic resistance to malaria can be describe as an inherited alteration or changes in the genetic material of humans specifically DNA molecule and other vital biomolecules which increases the chances of resistance to malaria and thus, result in an increased survival of individuals with those genetic alterations. In addition such changes also affect the general wellbeing and survival of the parasite to the extent that the parasite cannot even multiply or replicate itself while in such infected erythrocyte. This is because such alteration in the DNA molecule interferes with some of the vital chemical and biochemical processes of the parasite (Plasmodim spp). Therefore, several genetic disorders and or trait which include: Sickle cell disease, Glocose-6-Phosphatedehyrogenase deficiency, Pyruvate Kinase deficiency, Duffy antigen, Ovalocytocytosis, Thalassemia and ABO blood group are known to offer special protection against malaria disease in individuals who possessed at least one of such disorders or trait.

Malaria is a life-threatening parasitic disease which causes enormous morbidity and mortality in tropical African countries. Successful prevention and treatment of infected individuals heavenly depend on successful diagnosis using recommended techniques. These routine laboratory techniques have different performance indices. Therefore, this study aimed to evaluate the performance of Polymerase Chain Reaction and Microscopy in malaria diagnosis. A total of two hundred consented study subjects were randomly selected and enrolled for the research. Vein puncture technique was use to collect venus blood from the subjects and analysed using microscopy and Polymerase chain Reaction. DNA samples were extracted using Quick-DNA™ Miniprep Plus Kit with catalogue No. D4069. 18SrRNA gene of Plasmodium falciparum from chromosome 13 was amplified using the primers F5'AACAGACGGGTAGTCATGATTGAG3' R5'GTATCTGATCGTCTTCACTCCC3'. Malaria prevalence of 167(83.50%) and 105(52.5%) were recorded using microscopy and Polymerase Chain Reaction. Microscopy had a sensitivity, specificity, Positive predictive value and negative predictive value of 84.91, 23.40, 55.53 and 57.89%, respectively, with an overall accuracy value of 0.81. Polymerase Chain Reaction had a sensitivity value of 53.89%, specificity of 54.54%, positive predictive value of 85.79% and Negative predictive value of 18.94% with an overall accuracy of 0.54. Microscopy and Polymerase Chain Reaction demonstrated significant accuracy and relatively good performance indices. Therefore Microscopy and Polymerase Chain Reaction are highly recommended as malaria diagnostic techniques, and further research should be carried out to determine the influence of some biological factors of both the parasite and the host on the outcome of the diagnosis using both Polymerase Chain Reaction and microscopy.

Malaria control and its elimination heavenly depend on successful and reliable diagnosis using recommended diagnostic techniques. These available techniques often have certain peculiarities and mode applications, thus making them have different levels of performance and accuracy. Therefore the aim of this study was to evaluate the performance of PCR in relation to Rapid Diagnostic Test Kit (SD Bio line Malaria Ag P.f (05fk50)) in malaria diagnosis. A total of 200 blood samples were collected from the consented study subjects using the vein puncture technique and analysed using PCR and RDTs. Plasmodium falcifarum's DNA was extracted using Quick-DNA™ Miniprep Plus Kit with catalog number D4069. 18SrRNA gene of Plasmodium falciparum from chromosome 13 was amplified using the two primers. For the RDTs technique, the SD Bio line Malaria Ag P.f (05fk50) test kit was used. Malaria prevalence of 106(53.0%) and 132(66.0%) were recorded using PCR and RDTs respectively. The PCR demonstrates an overall accuracy of 0.53 with sensitivity and specificity values of 56.06 and 52.94% respectively. The negative and positive predictive values were 69.81 and 38.30% respectively. PCR demonstrated a good level of performance and is therefore recommended as an effective diagnostic tool for malaria, especially in patients where the parasite density/parasitaemia level is very low.

Successful malaria diagnosis is the mainstay of successful treatment, prevention and eradication of malaria infection. Apart from the gold standard technique (Microscopy), numerous diagnostic techniques perform a similar function to microscopy and in most cases tend to have varying sensitivity and specificity, especially when compared with the gold standard technique. Therefore this study aimed to determine the Performance and accuracy of SD Bioline Malaria Ag P.f (05fk50) (Rapid Diagnostic Test kit) to Gold standard (Microscopy). A total of two hundred (200) samples were collected from the consented study subjects and analyzed using RDT and Giemsa staining technique. The result revealed an overall prevalence of 132(66.0%) and 167(83.5%) respectively by RDT and Microscopy, where 115 (57.5%) were true positive, there was no significant difference between the two techniques (P> 0.05, df= 1, χ 2 = 3.695). The RDT recorded a sensitivity and specificity value of 68.86% and 48.48% respectively with a positive predictive value of 87.78% and a negative predictive value of 23.53%. The RDT recorded an overall accuracy of 0.66. The Rapid Diagnostic test kit used in the present demonstrated a high level of sensitivity and positive predictive value with relatively low specificity and negative predictive value. Regular checks on the Performance and accuracy of all brands of RDT should be conducted as their performance can be easily affected by some intrinsic and extrinsic factors.