Implementation of PEDS in well-child visits could enhance early detection of developmental problems, but many Thai parents were unable to mention their concerns about delayed abilities in the correct PEDS question. Therefore, to ensure higher sensitivity, criteria for referral should be adjusted and a second stage developmental evaluation may be incorporated with PEDS.

Children with Down syndrome often require several specialty doctors and multidisciplinary teams for their associated anomalies. This may impact their quality of life and creates gaps in treatment monitoring. No studies have yet been conducted in Thailand to measure their quality of life and level of comprehensive health supervision. Therefore, we aimed to study the quality of life among children with Down syndrome and determine if they receive comprehensive health supervision for their condition. In this descriptive research, data were collected from a medical record review of children with Down syndrome during a 1-year period in our Pediatric Outpatient Clinic; 50 children and 39 caregivers participated. Mean total quality of life score of the children was 67.9/100 points. The children had the highest scores (73.6 ± 12.8) in emotional functioning and the lowest (57.2 ± 25.6) in cognitive functioning. It appears that the quality of life may be lower in Down syndrome patients than in Thai children without it. Regarding health supervision, all 50 were screened for thyroid function, and 48 received cardiac evaluations. However, only 17 (34%) received "complete basic assessment" of 5 screening combinations with developmental evaluations and growth monitoring. Furthermore, none received "comprehensive" evaluations for all recommended conditions. While these findings show a need for health supervision improvement for children with Down syndrome within our hospital, they may also be indicative for most care facilities throughout Thailand.

IntroductionIn low-income and middle-income countries, it is estimated that one in every three preschool-age children are failing to meet cognitive or socioemotional developmental milestones. Thailand has implemented a universal national developmental screening programme (DSPM) for young children to enable detection of developmental disorders and early intervention that can improve child health outcomes. DSPM implementation is being hampered by low attendance at follow-up appointments when children fail the initial screening.MethodsAction research, using qualitative methods was conducted with 19 caregivers, 5 health workers and 1 chief at two Health Promotion Hospitals to explore the factors affecting attendance at follow-up appointments. Transcripts and notes were analysed using descriptive content analysis. Findings were then discussed with 48 health workers, managers, researchers and policymakers.ResultsThe high workload of health workers during busy vaccination clinics, and inadequate materials prevented clear communication with caregivers about the screening, how to stimulate child development and the screening result. Caregivers, particularly grandparents, had a lack of understanding about how to stimulate child development, and did not fully understand failed screening results. Caregivers felt blamed for not stimulating their child’s development, and were either worried that their child was severely disabled, or they did not believe the screening result and therefore questioned its usefulness. This led to a lack of attendance at follow-up appointments.ConclusionTask-sharing, mobile health (mhealth), community outreach and targeted interventions for grandparent caregivers might increase awareness about child development and screening, and allow health workers more time to communicate effectively. Sharing best practices, communication training and mentoring of DSPM workers coupled with mhealth job aids could also improve caregiver attendance at follow-up. Engagement of caregivers in understanding the barriers to attendance at follow-up and engagement of stakeholders in the design and implementation of interventions is important to ensure their effectiveness.

Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung’s disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung’s disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung’s disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype–phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30∗), c.207_8 delCG (p.Cys71Hisfs∗62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs∗42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs∗117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype–phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.

Purpose This study aims to develop a clinical prediction rule for the diagnosis of autistic spectrum disorder (ASD) in children. Design/methodology/approach This population-based study was carried out in children aged 2 to 5 years who were suspected of having ASD. Data regarding demographics, risk factors, histories taken from caregivers and clinical observation of ASD symptoms were recorded before specialists assessed patients using standardized diagnostic tools. The predictors were analyzed by multivariate logistic regression analysis and developed into a predictive model. Findings An ASD diagnosis was rendered in 74.8 per cent of 139 participants. The clinical prediction rule consisted of five predictors, namely, delayed speech for their age, history of rarely making eye contact or looking at faces, history of not showing off toys or favorite things, not following clinician’s eye direction and low frequency of social interaction with the clinician or the caregiver. At four or more predictors, sensitivity was 100 per cent for predicting a diagnosis of ASD, with a positive likelihood ratio of 16.62. Originality/value This practical clinical prediction rule would help general practitioners to initially diagnose ASD in routine clinical practice.