No abstract

The syntheses of certain analogues of the DNA minor groove binding agent Hoechst 33258 designed to exhibit altered sequence recognition are described. The structural modifications include the following: substitution of pyridine for the benzene ring of the benzimidazole moiety, replacement of one benzimidazole unit by a benzoxazole in the two possible orientations with respect to the DNA receptor, and a synthesis of 2,2'-m-phenylene-bis[6-(4-methyl-1-piperazinyl)benzimidazole]. Sequence recognition of these agents on a HindIII/EcoRI fragment of pBR322 DNA was determined by MPE footprinting procedures. Some of the analogues exhibited altered DNA sequence preference compared with Hoechst 33258. In particular, a structure bearing a benzoxazole moiety with the oxygen oriented inward to the minor groove together with an inward-directed pyridine nitrogen appears to confer the property of recognition of a GC base pair within the binding sequence. The possible factors, structural, stereochemical, and electrostatic, contributing to the altered DNA sequence recognition properties are discussed.

The binding to DNA of a mixed function ligand (NETGA) is described, in which a potential intercalating group, an acridine moiety, is incorporated at the carboxyl terminus of the minor groove binding oligopeptide netropsin skeleton. Scatchard analysis of absorption data provided evidence of two modes of binding to DNA with K1 = 9.1 x 10(5) M-1 at low r values (0.003-0.1), and a binding site size n = 10, indicative of binding of both moeities. At high binding ratios (greater than 0.1), K2 = 0.9 x 10(5) M-1 and n = 5 corresponding to external binding. Complementary strand MPE footprinting on a pBR322 restriction fragment showed NETGA binds to 5'-AAAT like netropsin. It causes enhanced cleavage by MPE, particularly at G-C rich sequences and remote from the preferred binding sites. Viscometry measurements provided evidence for biphasic modes of the two binding portions of NETGA. Fluorescence polarization and linear dichroism measurements were in accord with distinct modes of interaction of the acridine (intercalation) and oligopeptide (minor groove binding) portions of NETGA. LD measurements on NETGA indicate that the oligopeptide moiety (netropsin-like) has an orientation typical of minor groove binders, whereas the degree of intercalation of the acridine group is decreased by association of the oligopeptide moiety.

The sequence-preferential reversible covalent binding of certain saframycin antitumor antibiotics from Streptomyces lavendulae has been examined by complementary-strand methidium propyl-EDTA (MPE) footprinting on an EcoRI/HindIII restriction fragment of pBR322 DNA under several experimental conditions. A buffer at pH 7.4 and in the presence of 9.5 mM dithiothreitol at 37 degrees C was found to be optimum for the interaction of these antibiotics with DNA. At r' = 0.6 both saframycins A and S exhibited footprints in the regions 4244-4257 (CAAATAGGGTTCC) and 4265-4286 (TTCCCCAAAAGTGCCACCTG) and a weak footprint in the region 4297-4302 (AACCAT). The binding locations identified that are common to saframycins A and S are (all 5'----3') GGGG (4250-4253), CCCC (4268-4271), and GCC (4279-4281), and weak interaction locations are ACC (4282-4284 and 4298-4300) (underlined bases are shared by two adjacent binding sites). Both the antibiotic saframycins A and S show preference for 5'-GGG or 5'-GGC sequences. It appears that saframycin A has no affinity for 5'-CGG while saframycin S shows a strong footprint at this sequence. Neither of the saframycins recognizes alternating CG sequences. Saframycin S also binds to 5'-CTA, which suggests that molecular recognition processes involving the parent antibiotics are also important, and not only recognition by, and covalent binding of, the common iminium species to the DNA. The protection sites at 5'-GCC and 5'-ACC suggest that saframycins A and S recognize 5'-GGPy sequences. However, between the two pyrimidine bases, C is preferred to T. Enhancement of cleavage by both saframycins is observed in the AT-rich region of 4301-4318.(ABSTRACT TRUNCATED AT 250 WORDS)

Four different footprinting techniques have been used to probe the DNA sequence selectivity of Thia-Net, a bis-cationic analogue of the minor groove binder netropsin in which the N-methylpyrrole moieties are replaced by thiazole groups. In Thia-Net the ring nitrogen atoms are directed into the minor groove where they could accept hydrogen bonds from the exocyclic 2-amino group of guanine. Three nucleases (DNAase 1, DNAase 11, and micrococcal nuclease) were employed to detect binding sites on the 160bp tyr T fragment obtained from plasmid pKMA-98, and further experiments were performed with 1 1 7mer and 253mer fragments cut out of the plasmid pBS. MPE-Fe(ll) was used to footprint binding sites on an EcoRI/Hindlll fragment from pBR322. Thia-Net binds to sites in the minor groove containing 4 or 5 base pairs which are predominantly composed of alternating A and T residues, but with significant acceptance of intrusive GC base pairs. Unlike the parent antibiotic netropsin, Thia-Net discriminates against homooligomeric runs of A and T. The evident preference of Thia-Net for AT-rich sites, despite its containing thiazole nitrogens capable of accepting GC sites by hydrogen bonding, supports the view that the biscationic nature of the ligand imposes a bias due to the electrostatic potential differences in the receptor which favour the ligand reading alternating AT sequences. INTRODUCTIONSequence-specific molecular recognition of DNA by proteins is central to the regulation of many cellular processes (1,2). Examination of the interaction between oligopeptides and DNA can be useful as a means of elucidating the structural basis for such selectivity. Moreover, studies of the interaction of oligopeptides with DNA have become increasingly important for