In June 2012, watermelon leaves (Citrullus lanatus (Thunb.) Matsum. & Nakai) were observed with angular, necrotic spots with chlorotic halos in a field in Telfair County, GA. The field exhibited 20 to 25% disease incidence with no observable symptoms on fruits. Isolations were made from foliar lesions of 30 leaves onto yeast extract-dextrose–CaCO3 (YDC) agar medium (3). Yellow-pigmented, Xanthomonas-like colonies were observed after 48-h incubation at 28°C from 100% of the samples. Bacteria harvested were gram-negative, oxidase-negative, indole-negative, hydrolyzed starch and esculin, and formed pits on crystal violet pectate and carboxymethyl cellulose media. The bacterial isolates did not produce nitrites from nitrates but produced hypersensitive reactions on tobacco upon inoculation with 1 × 108 colony-forming units (CFU)/ml. These characteristics are typical of members of the Xanthomonas campestris group. The genus Xanthomonas was confirmed using conventional PCR with genus-specific primers RST2 (5′AGGCCCTGGAAGGTGCCCTGGA3′) and RST3 (5′ATCGCACTGCGTACCGCGCGCGA3′), which produced an 840-bp band. Universal primers fD1 and rD1 (1) were used to amplify the 16S rRNA gene from four isolates and amplified products were sequenced and BLAST searched in GenBank. The nucleotide sequences of the isolates showed 97 to 98% similarity to X. cucurbitae (Accessions AB680438.1 and Y10760), X. campestris (HQ256868.1), X. arboricola (JF835910.1), X. oryzae pv. oryzicola (CP003057.1) and X. campestris pv. raphani (CP002789.1). PCR amplification and sequencing of the atpD gene (ATP synthase, 720 bp) showed 99% similarity with X. cucurbitae when BLAST searched in GenBank (HM568911.1). X. cucurbitae was not present in the database of BIOLOG (Biolog, Hayward, CA); therefore, substrate utilization tests of three isolates were compared with substrate utilization patterns of Xanthomonas groups reported by Vauterin et al. (4). The watermelon isolates displayed 93.7, 89.5, and 89.5% similarity with the reported BIOLOG metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, none of the isolates were amplified using a conventional PCR assay with X. campestris pv. campestris and X. campestris pv. raphani-specific primers (2), indicating a closer relationship with X. cucurbitae. When 2-week old watermelon seedlings cv. Crimson sweet (n = 4/isolate/experiment) were inoculated by spraying with a suspension of 1 × 108 CFU/ml, 100% of the seedlings developed symptoms (water soaked angular lesions that developed into necrotic spots) 14 days after planting under greenhouse conditions (~30°C and ~70% RH). Ten control plants inoculated with sterile water remained asymptomatic. Bacterial colonies were reisolated from symptomatic seedlings that showed similar characteristics to those described above. The identity of isolated colonies was confirmed by amplifying and sequencing the 16S rRNA gene, which showed 97 to 98% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on watermelon in Georgia since the 1950s. References: (1) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (2) Leu et al. Plant Pathol. Bull. 19:137, 2010. (3) N. W. Schaad et al. Laboratory Guide for Identification of Plant Pathogenic Bacteria, 3rd ed. APS Press. St. Paul, MN, 2001. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

No abstract

Pecan scab, caused by the fungus Fusicladium effusum, is the most devastating disease of pecan (Carya illinoinensis) trees and is responsible for the majority of disease management efforts applied to that crop. The taxonomy of the fungus changed several times in the last decade and most recently, using ITS nrDNA data and conventional taxonomic methods, the organism was renamed F. effusum. In our study, a conserved region of the mitochondrial cytochrome b gene was sequenced from three isolates of F. effusum. The obtained sequences showed 95% nucleic acid and 100% amino acid homology (201-266 amino acids on exon 5 of the cytochrome b gene) with Venturia inaequalis (NCBI GenBank accession number AF047029). And in the maximum parsimony tree based on nucleotide sequences, F. effusum and V. inaequalis were clustered, with a 92% bootstrap value. The taxonomic classification of the pecan scab fungus was supported based on the cytochrome b region.

Xylella fastidiosa (Xf) is an emerging insect-vectored, xylem-limited bacterium that can cause disease on several economically important fruit and tree crops including almond, blueberry, citrus, grapevine, peach, and pecan. On blueberry, Xf causes bacterial leaf scorch (BLS), which is prevalent in the southeastern United States. This disease, previously reported to be caused by Xf subsp. multiplex (Xfm), can result in rapid plant decline and death of southern highbush (SHB) blueberry cultivars. In 2017, a survey of blueberry plantings in southern Georgia (U.S.A.) confirmed the presence of Xf-infected plants in eight of nine sites examined, and seven isolates were cultured from infected plants. Genetic characterization of these isolates through single-locus and multilocus sequence analysis revealed that three isolates from two sites belonged to Xf subsp. fastidiosa (Xff), with significant similarity to isolates from grapevine. After these three isolates were artificially inoculated onto greenhouse-grown SHB blueberries (cv. ‘Rebel’), symptoms typical of BLS developed, and Xff infection was confirmed through genetic characterization and reisolation of the bacterium to fulfill Koch’s postulates. Because all previously reported Xf isolates from blueberry have been characterized as Xfm, this is the first time that isolation of Xff has been reported from naturally infected blueberry plantings. The potential impact of Xff isolates on disease management in blueberry requires further exploration. Furthermore, given that isolates from both Xfm and Xff were obtained within a single naturally infected blueberry planting, blueberry in southern Georgia may provide opportunities for intersubspecific recombination between Xff and Xfm isolates.

Phellinus sulphurascens is the causal agent of laminated root rot, which attacks a number of conifer species, with Douglas-fir (Pseudotsuga menziesii) as its most economically important host. This chapter provides information on their distribution, detection, infection biology, epidemiology, and management strategies and tactics, which include avoidance, exclusion, eradication, protection, host resistance, therapy (treatment of currently infected plants), and integrated method of control.