This study was conducted to determine the Middle East Respiratory Syndrome Coronavirus infection rate among Iraqi dromedary camels and to explore its risk factor. A total of 167 blood samples were collected, ninety of them were selected randomly and included in the study from 50 males (55.6%) and 40 females (44.4%). The age range was 1-15 years. Samples were collected from Al Najaf-slaughter house. Sera were separated and tested for the presence of anti-MERS-CoV IgG using the recombivirus Camel anti-MERS-CoV spike protein S1 domain (MERS-S1) IgG ELISA kit. The results revealed that 81(90.0%) of camels included in this study were positive for anti-MERS-CoV IgG, with 95% confidence interval for the prevalence rate (82.5-94.9). Additionally, the Inter-quartile range of anti-MERS-CoV IgG titer was (5-19.7) and a mean rank of 99.8 U/ml. The highest positivity rate was among camels 10-15 years old with statistically insignificant difference (P= 0.88). Similarly, the anti-MERS-CoV IgG Ab titer was insignificantly higher in the same age group (P= 0.79). The anti- MERS-CoV IgG positivity rate was equally distributed among female and male camels (90.0%), so the difference was statistically insignificant (P=1). While the mean, median and Inter-quartile range of anti-MERSCoV-IgG titer was insignificantly higher among males compared to females (P=0.57). In conclusion, the majority of Iraqi camels are infected by MERS-CoV. Further studies are urgently needed to explore the ability of Iraqi camels to transmit the virus to human population.

Equine herpsvirus type1 was classified as a member of the subfamily Alphaherpesvirinae. It was reported to cause respiratory, reproductive and neurologic infection in horses. The reproductive form of the disease induces abortion in pregnant mare, while the neurologic form is associated with paralysis of infected horses. This study was designed for molecular detection of Equine herpsvirus type1 by polymerase chain reaction. Blood buffy coat samples were collected from 25 horses (Equus feruscaballus) and 25 donkeys (Equus asinus) admitted to local private veterinary clinics around Baghdad and Baaquba cities. DNA was extracted from such samples by the use of DNA extraction kit of COLLECTAGENET .The samples were subjected to conventional PCR test using specific primers for gB gene of equine herepesvirus-1. Forward primer (F) (5’ TAACTGAGATCT AACCGAC 3’) and reverse primer (R) (CATATATAGCTATCACGTCC 3’). One buffy coat sample from aborted mare and one buffy coat sample from a donkey suffering from acute respiratory clinical signs were inoculated in mice to follow the fate of equine herepesvirus-1in nasal turbinates, cervical lymph nodes and lungs of these mice. The results showed that only 4 samples from horses and 2 samples from donkeys were positive to polymerase chain reaction. Experimentally infected mice did not show any clinical signs but they were positive to polymerase chain reaction, and the virus easily terminated, probably due to low dose of the virus and host specificity. It can be concluded that local horses and donkeys, somewhere have had infected with equine herepesvirus-1, and became latent carriers for the virus. Furthermore, microbiological and epidemiological studies on local Equine herpsvirus type1 and Equine herpsvirus type 4 are recommended.

No abstract

Background and Aim: One of the primary pathogenic causes linked to economic losses in the chicken business is the infectious bronchitis virus. This virus exploited its S (spike) gene-encoded protein to hook into the host receptor. The biological diversity of the viral S gene may be linked to the chicken industry's vaccination status. Recently, the virus was detected in broilers of six farms located in different districts of Diyala Governorate by the use of RT-PCR. The current study aimed to explore the pattern of biological diversity of infectious bronchitis viruses based on the possibility of genetic variations of the S gene. Materials and Methods: Ten tissue samples were collected from broilers of six farms located in different districts of Diyala Governorate and named R1 to R10. The chickens were recently vaccinated, but naturally infected with infectious bronchitis virus; a particular RT-PCR fragment partially encompassing the coding domains of the S gene was recently obtained. The amplified fragments were immediately submitted to direct sequencing tests to examine the genetic variation pattern in the samples acquired from various chicken sources. Then unique comprehensive trees were generated to validate the correct genotyping of the identified variations and their phylogenetic distribution.

SummaryEquine herpsvirus type1 was classified as a member of the subfamily Alphaherpesvirinae. It was reported to cause respiratory, reproductive and neurologic infection in horses. The reproductive form of the disease induces abortion in pregnant mare, while the neurologic form is associated with paralysis of infected horses. This study was designed for molecular detection of Equine herpsvirus type1 by polymerase chain reaction. Blood buffy coat samples were collected from 25 horses (Equus feruscaballus) and 25 donkeys (Equus asinus) admitted to local private veterinary clinics around Baghdad and Baaquba cities. DNA was extracted from such samples by the use of DNA extraction kit of COLLECTAGENE T .The samples were subjected to conventional PCR test using specific primers for gB gene of equine herepesvirus-1. Forward primer (F) (5' TAACTGAGATCT AACCGAC 3') and reverse primer (R) (CATATATAGCTATCACGTCC 3'). One buffy coat sample from aborted mare and one buffy coat sample from a donkey suffering from acute respiratory clinical signs were inoculated in mice to follow the fate of equine herepesvirus-1in nasal turbinates, cervical lymph nodes and lungs of these mice. The results showed that only 4 samples from horses and 2 samples from donkeys were positive to polymerase chain reaction. Experimentally infected mice did not show any clinical signs but they were positive to polymerase chain reaction, and the virus easily terminated, probably due to low dose of the virus and host specificity. It can be concluded that local horses and donkeys, somewhere have had infected with equine herepesvirus-1, and became latent carriers for the virus. Furthermore, microbiological and epidemiological studies on local Equine herpsvirus type1 and Equine herpsvirus type 4 are recommended.