We recently developed a genome-length hepatitis C virus (HCV) RNA replication system (OR6) with luciferase as a reporter. The OR6 assay system has enabled prompt and precise quantification of HCV RNA replication. Pegylated interferon (IFN) and ribavirin combination therapy is the world standard for chronic hepatitis C, but its effectiveness is limited to about 55% of patients. Newer therapeutic approaches are needed. In the present study, we used the OR6 assay system to evaluate the anti-HCV activity of 3-hydroxy-3-methylglutaryl coenzyme A ( P ersistent hepatitis C virus (HCV) infection causes liver fibrosis and hepatocellular carcinoma. Approximately 170 million people worldwide are infected with HCV. The combination of pegylated interferon (IFN) with ribavirin is the current standard therapy for chronic hepatitis C (CHC) and yields a sustained virological response (SVR) rate of about 55%. 1 This means that about 45% of patients with CH C are still threatened by the progression of the disease to cirrhosis and hepatocellular carcinoma. Until 1999, when Lohmann et al. developed the subgenomic replicon of HCV, it was difficult to screen anti-HCV reagents. 2 Many improvements followed that breakthrough, such as a genome-length HCV RNA replication system 3,4 and a subgenomic replicon with a reporter assay system 5 ; more recently, Wakita et al. used a genotype 2a strain, JFH1, to produce the infectious virus in cell culture. [6][7][8] Genotype 1 is the major genotype of HCV found in Japan, the United States, and many other countries. Unfortunately, the SVR rate after combination therapy of pegylated IFN with ribavirin is less than 50% for this genotype. To find a more effective therapy especially for CHC patients with genotype 1, we recently developed a genome-length HCV RNA (strain O of genotype 1b) replication reporter system (OR6), which has been an effective screening tool. 9,10 Statins, which are 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitors, are in wide use for the treatment of hypercholesterolemia. Recently, it

No abstract

General anesthetics (GAs) have transformed surgery through their actions to depress the central nervous system and blunt the perception of surgical insults. Counterintuitively, many of these agents activate peripheral nociceptive neurons. However, the underlying mechanisms and significance of these effects have not been explored. Here, we show that clinical concentrations of noxious i.v. and inhalation GAs excite sensory neurons by selectively activating TRPA1, a key ion channel in the pain pathway. Further, these GAs induce pain-related responses in mice that are abolished in TRPA1-null animals. Significantly, TRPA1-dependent neurogenic inflammation is greater in mice anesthetized with pungent compared with nonpungent anesthetics. Thus, our results show that TRPA1 is essential for sensing noxious GAs. The pronociceptive effects of GAs combined with surgical tissue damage could lead to a paradoxical increase in postoperative pain and inflammation.

DDX3, a DEAD-box RNA helicase, binds to the hepatitis C virus (HCV) core protein. However, the role(s) of DDX3 in HCV replication is still not understood. Here we demonstrate that the accumulation of both genome-length HCV RNA (HCV-O, genotype 1b) and its replicon RNA were significantly suppressed in HuH-7-derived cells expressing short hairpin RNA targeted to DDX3 by lentivirus vector transduction. As well, RNA replication of JFH1 (genotype 2a) and release of the core into the culture supernatants were suppressed in DDX3 knockdown cells after inoculation of the cell culture-generated HCVcc. Thus, DDX3 is required for HCV RNA replication.DEAD-box RNA helicases are involved in various RNA metabolic processes, including transcription, translation, RNA splicing, RNA transport, and RNA degradation (9,20). DDX1 and DDX3, DEAD-box RNA helicases, have been implicated in the replication of human immunodeficiency virus type 1 (HIV-1). Both DDX1 and DDX3 interact with HIV-1 Rev and enhance Rev-dependent HIV-1 RNA nuclear export (10,24).On the other hand, DDX3 binds to the hepatitis C virus (HCV) core protein (17,19,25), and DDX3 expression is deregulated in HCV-associated hepatocellular carcinoma (HCC) (7,8). However, the biological function of DDX3 in HCV replication is still not understood. To address this issue, we first used lentivirus vector-mediated RNA interference to stably knock down DDX3 in three HuH-7-derived cell lines: O cells, harboring a replicative genome-length HCV RNA (HCV-O, genotype 1b) (13); sO cells, harboring its subgenomic replicon of HCV RNA (14); or RSc cured cells, which cell culture-generated HCV (HCVcc) (JFH1, genotype 2a) (23) could infect and effectively replicate in (M. Ikeda et al., unpublished data). Oligonucleotides with the following sense and antisense sequences were used for the cloning of short hairpin RNA (shRNA)-encoding sequences against DDX3 in the lentivirus vector: for DDX3i#3, 5Ј-GATCCCCGGAGGA AATTATAACTCCCTTCAAGAGAGGGAGTTATAATTT CCTCCTTTTTGGAAA-3Ј (sense) and 5Ј-AGCTTTTCCAA AAAGGAGGAAATTATAACTCCCTCTCTTGAAGGGA GTTATAATTTCCTCCGGG-3Ј (antisense); for DDX3i#7, 5Ј-GATCCCCGGTCACCCTGCCAAACAAGTTCAAGAG ACTTGTTTGGCAGGGTGACCTTTTTGGAAA-3Ј (sense) and 5Ј-AGCTTTTCCAAAAAGGTCACCCTGCCAAACAA GTCTCTTGAACTTGTTTGGCAGGGTGACCGGG-3Ј (antisense). These oligonucleotides were annealed and subcloned into the BglII-HindIII site, downstream from an RNA polymerase III promoter of pSUPER (6). To construct pLVDDX3i#3 and pLV-DDX3i#7, the BamHI-SalI fragments of the corresponding pSUPER plasmids were subcloned into the BamHI-SalI site of pRDI292 (5), an HIV-1-derived self-inactivating lentivirus vector containing a puromycin resistance marker allowing for the selection of transduced cells. The vesicular stomatitis virus G protein (VSV-G)-pseudotyped HIV-1-based vector system has been described previously (18). We used the second-generation packaging construct pCMV-⌬R8.91 (26) and the VSV-G-envelope plasmid pMDG2. The lentivirus vector particles were produced by transient transfection of 293FT cells with FuGe...

Neuropeptide Y (NPY) is a sympathetic neurotransmitter recently found to be potently angiogenic and growth promoting for endothelial, vascular smooth muscle and neuronal cells. NPY and its cognate receptors, Y1, Y2 and Y5, are expressed in neural crest-derived tumors; however, their role in regulation of growth is unknown. The effect of NPY on the growth and vascularization of neuroendocrine tumors was tested using three types of cells: neuroblastoma, pheochromocytoma, and Ewing's sarcoma family of tumors (ESFT). The tumors varied in expression of NPY receptors, which was linked to differential functions of the peptide. NPY stimulated proliferation of neuroblastoma cells via Y2/Y5Rs and inhibited ESFT cell growth by Y1/Y5-mediated apoptosis. In both tumor types, NPY receptor antagonists altered basal growth levels, indicating a regulatory role of autocrine NPY. In addition, the peptide released from the tumor cells stimulated endothelial cell proliferation, which suggests its paracrine angiogenic effects. In nude mice xenografts, exogenous NPY stimulated growth of neuroblastoma tumors, whereas it increased apoptosis and reduced growth of ESFT. However, in both tumors, NPY treatment led to an increase in tumor vascularization. Taken together, this is the first report of NPY being a growth-regulatory factor for neuroendocrine tumors, acting both by autocrine activation of tumor cell proliferation or apoptosis and by angiogenesis. NPY and its receptors may become targets for novel approaches in the treatment of these diseases, directed against both tumor cell proliferation and angiogenesis. (Cancer Res 2005; 65(5): 1719-28)