Fluorescence in situ hybridization of a tile path of DNA subclones has previously enabled the cyto-genetic definition of the minimal DNA sequence which spans the FRA16D common chromosomal fragile site, located at 16q23.2. Homozygous deletion of the FRA16D locus has been reported in adenocarcinomas of stomach, colon, lung and ovary. We have sequenced the 270 kb containing the FRA16D fragile site and the minimal homozygously deleted region in tumour cells. This sequence enabled localization of some of the tumour cell breakpoints to regions which contain AT-rich secondary structures similar to those associated with the FRA10B and FRA16B rare fragile sites. The FRA16D DNA sequence also led to the identification of an alternatively spliced gene, named FOR (fragile site FRA16D oxidoreductase), exons of which span both the fragile site and the minimal region of homozygous deletion. In addition, the complete DNA sequence of the FRA16D-containing FOR intron reveals no evidence of additional authentic transcripts. Alternatively spliced FOR transcripts (FOR I, FOR II and FOR III) encode proteins which share N-terminal WW domains and differ at their C-terminus, with FOR III having a truncated oxidoreductase domain. FRA16D-associated deletions selectively affect the FOR gene transcripts. Three out of five previously mapped translocation breakpoints in multiple myeloma are also located within the FOR gene. FOR is therefore the principle genetic target for DNA instability at 16q23.2 and perturbation of FOR function is likely to contribute to the biological consequences of DNA instability at FRA16D in cancer cells.

tRNA modifications are crucial for efficient and accurate protein synthesis, and modification defects are frequently associated with disease. Yeast trm7Δ mutants grow poorly due to lack of 2'-O-methylated C32 (Cm32) and Gm34 on tRNAPhe, catalyzed by Trm7-Trm732 and Trm7-Trm734 respectively, which in turn results in loss of wybutosine at G37. Mutations in human FTSJ1, the likely TRM7 homolog, cause non-syndromic X-linked intellectual disability (NSXLID), but the role of FTSJ1 in tRNA modification is unknown. Here we report that tRNAPhe from two genetically independent cell lines of NSXLID patients with loss of function FTSJ1 mutations nearly completely lacks Cm32 and Gm34, and has reduced peroxywybutosine (o2yW37). Additionally, tRNAPhe from an NSXLID patient with a novel FTSJ1-p.A26P missense allele specifically lacks Gm34, but has normal levels of Cm32 and o2yW37. tRNAPhe from the corresponding Saccharomyces cerevisiae trm7-A26P mutant also specifically lacks Gm34, and the reduced Gm34 is not due to weaker Trm734 binding. These results directly link defective 2'-O-methylation of the tRNA anticodon loop to FTSJ1 mutations, suggest that the modification defects cause NSXLID, and may implicate Gm34 of tRNAPhe as the critical modification. These results also underscore the widespread conservation of the circuitry for Trm7-dependent anticodon loop modification of eukaryotic tRNAPhe.

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)n trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATA TTATATATTATATCTAATAATATATC/ATA)n (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

It is estimated that ∼1% of the world's population has intellectual disability, with males affected more often than females. is an X-linked gene encoding for the enzymeGlcNAc transferase (OGT), which carries out the reversible addition of -acetylglucosamine (GlcNAc) to Ser/Thr residues of its intracellular substrates. Three missense mutations in the tetratricopeptide (TPR) repeats of OGT have recently been reported to cause X-linked intellectual disability (XLID). Here, we report the discovery of two additional novel missense mutations (c.775 G>A, p.A259T, and c.1016 A>G, p.E339G) in the TPR domain of OGT that segregate with XLID in affected families. Characterization of all five of these XLID missense variants of OGT demonstrates modest declines in thermodynamic stability and/or activities of the variants. We engineered each of the mutations into a male human embryonic stem cell line using CRISPR/Cas9. Investigation of the global GlcNAc profile as well as OGT andGlcNAc hydrolase levels by Western blotting showed no gross changes in steady-state levels in the engineered lines. However, analyses of the differential transcriptomes of the OGT variant-expressing stem cells revealed shared deregulation of genes involved in cell fate determination and liver X receptor/retinoid X receptor signaling, which has been implicated in neuronal development. Thus, here we reveal two additional mutations encoding residues in the TPR regions of OGT that appear causal for XLID and provide evidence that the relatively stable and active TPR variants may share a common, unelucidated mechanism of altering gene expression profiles in human embryonic stem cells.