containing 1 x 106 cpm of nick-translated probe per ml (12). After being washed three times at 60'C in 0.5 x SSC to remove excess probe, the filters were exposed to X-ray film (Kodak X-Omat S) at -700C with an intensifying screen. Hybridization-positive phage were isolated, and their inserts were subcloned into the EcoRI site of M13mp8. AVDR1 was obtained in this fashion and subsequently used to screen an Okayama-Berg (13) T47D cDNA library (provided by G. Ringold, Stanford University), yielding clone VDR3, and a specifically primed AgtlO T47D library yielding clone AVDR2. The latter was made by substituting the oligonucleotide 5' ACACACCCCACAGATCCGGGG 3' for oligo(dT) in the first strand reaction (underlined in Fig. 2).DNA Sequence Analysis. Three overlapping clones were used to generate the full-length VDR sequence cDNA inserts to be sequenced. These clones were subcloned into the EcoRI site of M13mp8 for sequencing by the dideoxynucleotide chain-termination method (14). Primers were either the M13 universal primer or sequence-derived oligonucleotides.RNA Blot Hybridization. Total RNA was isolated from each of three cell lines (15), and the mRNA fraction was selected by successive passages over oligo(dT)-cellulose (16). The mRNA samples (10 ,ug) were resolved on a 1% formaldehyde-agarose gel (17) and then transferred electrophoretically to a nylon membrane (Nytran; Schleicher & Schuell). The filter was hybridized to nick-translated hVDR-1(1 x 108 cpm/,ug; 1 x 106 cpm/ml) using the conditions described above.Expression

No abstract

The leading cause of morbidity and mortality in cystic fibrosis (CF) patients stems from repeated bacterial respiratory infections. Many bacterial species have been cultured from CF specimens and so are associated with lung disease. Despite this, much remains to be determined. In the present study, we characterized without prior cultivation the total bacterial community present in specimens taken from adult CF patients, extracting DNA directly from 14 bronchoscopy or sputum samples. Bacterial 16S ribosomal DNA (rRNA) gene PCR products were amplified from extracted nucleic acids, with analyses by terminal restriction fragment length polymorphism (T-RFLP), length heterogeneity PCR (LH-PCR), and sequencing of individual cloned PCR products to characterize these communities. Using the same loading of PCR products, 12 distinct T-RFLP profiles were identified that had between 3 and 32 T-RFLP bands. Nine distinct LH-PCR profiles were identified containing between one and four bands. T-RFLP bands were detected in certain samples at positions that corresponded to pathogens cultured from CF samples, e.g., Burkholderia cepacia and Haemophilus influenzae. In every sample studied, one T-RFLP band was identified that corresponded to that produced by Pseudomonas aeruginosa. A total of 103 16S rRNA gene clones were examined from five patients. P. aeruginosa was the most commonly identified species (59% of clones). Stenotrophomonas species were also common, with eight other (typically anaerobic) bacterial species identified within the remaining 17 clones. In conclusion, T-RFLP analysis coupled with 16S rRNA gene sequencing is a powerful means of analyzing the composition and diversity of the bacterial community in specimens sampled from CF patients.

Preimplantation diagnosis of the delta F508 deletion causing cystic fibrosis is possible through in vitro fertilization, biopsy of a cleavage-stage embryo, and amplification of DNA from single embryonic cells. This approach should be equally applicable to other single-gene diseases in which the defect has been identified. Analysis of a series of pregnancies, however, will be required to assess the method adequately.