Adenosine deaminase (ADA) is expressed ubiquitously by diverse mammalian cells and tissues but at levels that vary according to tissue and species. In humans, the thymus exhibits levels of the enzyme up to 100-fold higher than most other tissues. Using transgenic mice, we identified human ADA gene regulatory domains. Up to 3.7 kb of 5'-flanking and first exon DNA from the human ADA gene failed to promote the expression of a chloramphenicol acetyl transferase (CAT) reporter gene in an efficient, reproducible, or tissue-appropriate manner in transgenic mice. However, when 12.8 kb of DNA from the first intron of the human ADA gene was placed 3' of CAT-coding and -processing sequences, transgenic mice reproducibly expressed CAT activity in most tissues, with profoundly high levels in the thymus. DNase I hypersensitivity studies demonstrated that among transgenic mouse tissues, human thymus, and a variety of human cell lines, a region of the intron 4-10 kb downstream of the first exon exhibited an array of hypersensitive sites that varied according to tissue and cell type. Deletion of this region from the gene construction eliminated high-level expression in transgenic mice. In transfection-transient expression assays, the 12.8-kb intron fragment exhibited enhancer activity in several cell types. A 1.3-kb fragment encompassing two of the hypersensitive sites exhibited some of these activities. The results of these studies suggest that the diverse pattern of human ADA gene expression is determined, in part, by a cluster of cis-regulatory elements contained within its large first intron.

We previously observed that human ADA gene expression, required for the intrathymic maturation of T cells, is controlled by first-intron sequences. Used as a cis activator, the intron generates copy-dependent reporter expression in transgenic thymocytes, and we here dissect its critical determinants. Of six DNase I-hypersensitive sites (HS sites) in the intron, only HS III was a transfection-active classic enhancer in T cells. The enhancer contains a critical core region, ACATGGCAGTTGGTGGTGGAGGGGAACA, that interacts with at least two factors, ADA-NF1 and ADA-NF2. Activity of the core is strongly augmented by adjacent elements contained within a 200-bp domain corresponding to the limits of HS III hypersensitivity. These core-adjacent sequences include consensus matches for recognition by the AP-1, TCF-lac, ,E, and Ets transcription factor families. In contrast, considerably more extensive sequences flanking the enhancer domain were required for position-independent and copy-proportional expression in transgenic mouse thymocytes. The additionally required upstream segment encompassed the nonenhancer HS II site. The required downstream segment, composed largely of Alu-repetitive DNA, was non-DNase I hypersensitive. Transgenes that lacked either segment were subject to strong positional effects. Among these variably expressing lines, the expression level correlated with the degree of hypersensitivity at HS III. This finding suggests that formation of hypersensitivity is normally facilitated by the flanking segments. These results delineate a complex thymic regulatory region within the intron and indicate that a series of interactions is necessary for the enhancer domain to function consistently within chromatin.

Adenosine deaminase (ADA) is expressed at high levels in the epithelium of proximal small intestine. Transgenic mice were used to characterize the regulatory region governing this activation. A duodenum-specific enhancer is located in intron 2 of the human ADA gene at the central site among a cluster of seven DNase I-hypersensitive sites present in duodenal DNA. Flanking DNA, including the remaining hypersensitive sites, is required for consistent high-level enhancer function. The enhancer activates expression in a pattern identical to endogenous ADA along both the anterior-posterior axis of the small intestine and the crypt-villus differentiation axis of the intestinal epithelium. Timing of activation by the central enhancer mimics endogenous mouse ADA activation, occurring at 2-3 wk of age. However, two upstream DNA segments, one proximal and one distal, collaborate to change enhancer activation to a perinatal time point. Studies with duodenal nuclear extracts identified five distinct DNase I footprints within the enhancer. Protected regions encompass six putative binding sites for the transcription factor PDX-1, as well as proposed CDX, hepatocyte nuclear factor-4, and GATA-type sites.

Formation of the mammalian gastrointestinal tract is an ordered process of development and differentiation. Yet, the adult small intestine also retains the plasticity to respond to cues both internal and environmental to modulate intestinal function. The components that regulate this development, differentiation, and modulation at the molecular level are only now being elucidated. We have used the human adenosine deaminase (ADA) gene as a model to identify potential cis-regulatory components involved in these processes within the small intestine. In mammals, high levels of ADA in the small intestine are limited specifically to the differentiated enterocytes within the duodenal region. These studies describe the identification of a region of the human ADA gene, completely distinct from the previously identified T-cell enhancer, which is capable of directing the human intestinal expression pattern in the intestine of transgenic mice. The reporter gene expression pattern observed in these transgenic mice is identical to the endogenous gene along both the cephalocaudal and crypt/villus axis of development. Timing of this transgene activation, however, varies from that of the endogenous mouse gene in that the transgene is activated approximately 2 weeks earlier in development. Even so, this precocious activation is also limited to the epithelium of the developing villi strictly within the duodenal region of the small intestine.

The purine metabolic gene adenosine deaminase ( ADA) is expressed at high levels in a well-defined spatiotemporal pattern in the villous epithelium of proximal small intestine. A duodenum-specific enhancer module responsible for this expression pattern has been identified in the second intron of the human ADA gene. It has previously been shown that binding of the factor PDX-1 is essential for function of this enhancer. The studies presented here examine the proposed roles of GATA factors in the enhancer. Site-directed mutagenesis of the enhancer's GATA binding sites crippled enhancer function in 10 lines of transgenic mice, with 9 of the lines demonstrating <1% of normal activity. Detailed studies along the longitudinal axis of mouse small intestine indicate that GATA-4 and GATA-5 mRNA levels display a reciprocal pattern, with low levels of GATA-6 throughout. Interestingly, gel shift studies with duodenal nuclear extracts showed binding only by GATA-4.