The cis-acting regulatory sequence of transcription from long terminal repeats (LTRs) of human T-cell leukemia virus type I and type II (HTLV-I and HTLV-II), which is essential for action of the virally encoded trans-acting transcriptional factor(s) designated pX(s), in HTLV-I and -II was identified. Deletion of most of the U3 region of the HTLV-I LTR resulted in loss of trans-acting transcriptional activation. However, when a tandem repeat of a 21-nucleotide sequence (GAAGGCTCTGACGTCTCCCCC) that is present in the U3 region of HTLV-I and -II LTRs was inserted into the deleted U3 region of the HTLV-I LTRs, chloramphenicol acetyltransferase activity was restored. The extent ofrestoration ofactivity was proportional to the number of copies of the sequence inserted. To test the possibility that the 21-nucleotide sequence alone is necessary for trans-activation, a sequence (AG-GAACTGAAA) homologous to a type-specific viral enhancer sequence and present in the U3 region of HTLV-II LTR, but not in the same region of the HTLV-I LTR, was inserted together with the 21-nucleotide sequence into the deleted U3 region of the HTLV-I LTR. However, no significant differences of the levels of activities of those LTRs compared to the LTRs with only the 21-nucleotide sequence repeats were observed.Human T-cell leukemia viruses type I and type II (HTLV-I and HTLV-II) transform normal human lymphocytes in vitro (1-4). Thus, some factors encoded by these viruses are probably responsible for the transformation. The genome of HTLV has a unique feature relative to most other retroviruses: an extra sequence, pX (or X), between env and the 3' LTR (5, 6). Proteins of 41 kDa (7, 8) [or 40 kDa (9,10) or 42 kDa (11)] of HTLV-I and 38 kDa of HTLV-II encoded by the largest open reading frames in the pX (or X) region have been identified (7,8). In addition to these proteins, other proteins encodable by different reading frames in this pX region of HTLV-I (12) and HTLV-II also have been identified (unpublished data). However, enhancement of transcriptional activity from long terminal repeats (LTRs) of HTLVs was observed in cells that express only pX protein(s) encoded by the largest open reading frame as a viral protein, suggesting that this protein(s) alone is responsible for trans-acting transcriptional activation (13-18). Several groups have been attempting to localize the DNA sequence that responds to a virally encoded trans-acting transcriptional factor(s) in HTLV-I, -II, and bovine leukemia virus (19-23).Comparison of the LTRs of HTLV-I and HTLV-II revealed the presence of conserved nucleotide sequence stretches in the "TATA" region, cap site, poly(A) site, and U region (24). The conserved nucleotide sequence in the U3 region consists of a 21-nucleotide (21-nt) sequence that is repeated three times with some distance (24). This sequence is thought to be an enhancer sequence for transcription, since enhancer-like sequences are known to be located in the U3 region of Molony murine leukemia virus (Mo-MLV) (25) and Rous sarcoma virus (RS...

No abstract

No abstract

No abstract

Human T-cell leukemia virus type II (HTLV-II) isolated from a T-cell variant of hairy cell leukemia contains gag, pol and env genes as well as a fourth gene termed X, which can code three major open reading frames Xa, Xb and Xc. Proteins with molecular masses of 26 kDa (~26~~) and 24 kDa (~24~~) encoded by the Xb open reading frame were identified with antisera directed against synthetic peptides corresponding to the N-terminal and C-terminal amino acid sequences deduced from the structure of the Xb open reading frame. More than half the Xb products were found to be located in the nuclear fraction of HTLV-II-infected cells.