The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.

Large expansions of a non-coding GGGGCC-repeat in the first intron of the C9orf72 gene are a common cause of both amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). G-rich sequences have a propensity for forming highly stable quadruplex structures in both RNA and DNA termed G-quadruplexes. G-quadruplexes have been shown to be involved in a range of processes including telomere stability and RNA transcription, splicing, translation and transport. Here we show using NMR and CD spectroscopy that the C9orf72 hexanucleotide expansion can form a stable G-quadruplex, which has profound implications for disease mechanism in ALS and FTD.

Native disulfide bonds in therapeutic proteins are crucial for tertiary structure and biological activity and are therefore considered unsuitable for chemical modification. We show that native disulfides in human interferon alpha-2b and in a fragment of an antibody to CD4(+) can be modified by site-specific bisalkylation of the two cysteine sulfur atoms to form a three-carbon PEGylated bridge. The yield of PEGylated protein is high, and tertiary structure and biological activity are retained.