Nuclear factor I (NFI) is a group of related site-specific DNA-binding proteins that function in adenovirus DNA replication and cellular RNA metabolism. We have measured both the levels and forms of NFI that interact with a well-characterized 26-base-pair NFI-binding site. Five different NFI-DNA complexes were seen in HeLa nuclear extracts by using a gel mobility shift (GMS) assay. In addition, at least six forms of NFI were shown to cross-link directly to DNA by using a UV cross-linking assay. (13,30,34,36,46). Analysis of this site and a number of other NFI-binding sites revealed a consensus sequence, TGGC/A(N)5GCCAA, required for optimal binding (4, 9, 11). In addition, flanking sequences and the length and composition of the 5-base-pair spacer region can greatly modulate binding efficiency (9).NFI-binding sites are present within the promoters of viral (14, 18, 42) and cellular (7,19,23,38,39) (17,19,41).Purification of NFI from HeLa cells has revealed a number of polypeptides, ranging in size from 52 to 66 kilodaltons (kDa), which constitute a family of NFI proteins (35). In addition, multiple mRNA species encoding NFI-family proteins have been detected from hamster (7), rat (32), porcine (27), and human (27, 41) sources.We have used nitrocellulose filter binding, gel mobility shift (GMS) analysis, and UV cross-linking to assess the levels and forms of NFI present in various cell lines. Multiple specific protein-DNA complexes have been detected in nuclear extracts. In addition, cell-line-specific differences in both the forms and the absolute amounts of NFI binding activity were observed. MATERIALS AND METHODSSynthetic oligonucleotides. Oligonucleotides were made on an Applied Biosystems model 280A DNA synthesizer. Oligonucleotides FIB-2.6 (AGGTCTGGC'ITTGGGCCAAGA * Corresponding author. GCCGC) and FIB-2.6C2 (AGGTCTCGCTTTGGGCCAAG AGCCGC) were made duplex by hybridization of a primer (GCGGCTCTTGGC), followed by extension using the large fragment of DNA polymerase I as previously described (9). When labeled with [a-32P]dCTP, the initial specific activity of the duplex fragments was about 10,000 cpm/fmol.Competitor DNA. Plasmid competitor DNAs were prepared by alkaline lysis and sedimentation through cesium chloride gradients (25). pTAd contains the sequence AATTG GCTTGAAGCCAACTAGATC cloned between the EcoRI and BamHI sites of pTZ18R (Pharmacia, Inc.). This sequence contains the NFI-binding site from the adenovirus type 5 origin of replication with a point mutation that increases binding about fourfold (36; unpublished results). Plasmids pTZEa and pTZTK contain the oligonucleotides ACT'TTTAACCAATCAGAAAAAT and CGAATTCGCCA ATGACAAGACGC, respectively, cloned into the SmaI site of pTZ18R. The Ea oligonucleotide contains the CCAATbinding site for NF-Y/CP1 from the murine major histocompatibility complex class II locus (5), and the TK oligonucleotide contains the CCAAT box from the herpes simplex virus thymidine kinase gene (8).GMS assay. 32P-labeled oligonucleotide (10 fmol) was incubated with crude nuclear extract...

No abstract

Nuclear factor I (NFI) is a group of related site-specific DNA-binding proteins that function in adenovirus DNA replication and cellular RNA metabolism. We have measured both the levels and forms of NFI that interact with a well-characterized 26-base-pair NFI-binding site. Five different NFI-DNA complexes were seen in HeLa nuclear extracts by using a gel mobility shift (GMS) assay. In addition, at least six forms of NFI were shown to cross-link directly to DNA by using a UV cross-linking assay. The distinct GMS complexes detected were composed of different subspecies of NFI polypeptides as assayed by UV cross-linking. Different murine cell lines possessed varying levels and forms of NFI binding activity, as judged by nitrocellulose filter binding and GMS assays. The growth state of NIH 3T3 cells affected both the types of NFI-DNA complexes seen in a GMS assay and the forms of the protein detected by UV cross-linking.