Mycotoxins are secondary metabolites produced by some filamentous fungi, which can cause toxic effects in humans and animals. The purpose of the study was to report the influence of postharvest conditions of grains and animal feed on the occurrence of mycotoxins in milk and dairy products which are widely consumed worldwide and have several health benefits for consumers. Among the most toxic mycotoxins are aflatoxins (AFs), with AFB 1 being the most toxic and present in grains and cereals used in the feeding of dairy cows. After ingestion, AFB 1 is converted to AFM 1 , which is excreted in milk, being a source of direct contamination to consumers of this product and dairy products. Thus, knowledge about this substance and the care that can be taken to reduce the consumption of contaminated food is a matter of great importance concerning public health and food safety. This review reports that the temperature and humidity at which the grains are stored, are the main conditions that can be controlled during storage, aiming to reduce the growth of fungi and the production of mycotoxins. This work reinforces that the continuous control of mycotoxins in milk and dairy products is of vital importance to obtain a safe product. Besides, strategies to mitigate the development of fungal contamination have been carefully revised to prevent the formation of these toxic substances.

Flaxseed (Linum usitatissimum L.) displays functional properties and contains α-linolenic acid (omega-3). It also contains soluble and insoluble fiber, lignans, phenolic acids, flavonoids, phytic acid, vitamins, and minerals. However, its microbiota can cause fungal contaminations, drastically reducing its quality. The objective of this work was to identify the fungi present in bulk flaxseed through the internal transcribed spacer (ITS1) intergenic region using a metataxonomics approach. Fungal identification was performed via high-performance sequencing of the ITS1 region using ITS1 (GAACCWGCGGARGGATCA) and ITS2 (GCTGCGTTCTTCATCGATGC) as primers with 300 cycles and single-end sequencing in the MiSeq Sequencing System equipment (Illumina Inc., San Diego, CA, USA). Six genera and eight species of fungi were found in the sample. The genus Aspergillus stood out with three xerophilic species found, A. cibarius, A. Appendiculatus, and A. amstelodami, the first being the most abundant. The second most abundant genus was Wallemia, with the species W. muriae. This is one of the fungi taxa with great xerophilic potential, and some strains can produce toxins. Metataxonomics has proved to be a complete, fast, and efficient method to identify different fungi. Furthermore, high-performance genetic sequencing is an important ally in research, helping to develop novel technological advances related to food safety.

Várias espécies de parasitas podem ser encontradas em peixes, tanto in natura quanto processados, o que constitui um potencial risco para a saúde pública. O hábito de consumir alimentos sem cocção, está cada vez maior entre as populações, o que pode ser associado a possibilidade de uma maior incidência de contaminação parasitária e exposição do consumidor. Inclusive, doenças que não faziam parte do cotidiano de diversos países, têm sido introduzidas pela importação de espécies de peixes não nativas. Enquanto muitas infecções são endêmicas e tendem a causar sintomas como dor abdominal moderada, alguns casos podem ser fatais na falta de intervenção médica apropriada. Além disso, são indicativo de má qualidade do ambiente de criação dos peixes e da presença de microrganismos patogênicos na matéria prima. As infecções com esses parasitas podem ser prevenidas tanto pelo cuidado durante a captura em águas certificadas (estuários) de peixes de vida livre e controladas (tanques/gaiolas) em cativeiro/piscicultura, bem como preparo do alimento (com cocção por tempo e temperatura adequados). O presente trabalho investigou dados da literatura referentes à contaminação por parasitas em peixes da culinária internacional, suas características, enfermidades, níveis de contaminação, bem como procedimentos de prevenção / controle e descontaminação, utilizando métodos brandos. Termos para indexação: contaminação, ictioparasitologia, pescado, prevenção.