11Pediocin PA-1 is an antimicrobial peptide which has a strongly activity against some Gram -12 positive pathogens such as Listeria monocytogenes, Staphylococcus aureus, Enterococcus 13 faecalis…With the broad inhibitory spectrum as well as pH and temperature stability, pediocin has a 14 potential application in food preservation as well as pharmaceutical industry. For higher manufactory 15 efficiency, pediocin has been expressed in both prokaryote and eukaryote heterologous expression 16 system, mostly on Escherichia coli with different strategies. Here, we show a new strategy to produce 17 pediocin from Escherichia coli BL21(DE3) system as fusion form by using a vector containing NusA 18 tag. Our results showed that NusA fused pediocin almost presented in soluble form with high efficiency 19 (79.8 mg/l obtained by Ni-NTA purification). After remove the fusion tag, recombinant pediocin 20 showed antimicrobial activity against Listeria monocytogenes ATCC 13932 as 23.5x10 3 Au/mg as well 21 as against Enterococcus faecalis, Lactobacillus plantarum, and Streptococcus thermophilus, especially 22 Vibrio parahaemolyticus -a Gram-negative bacteria which have not been reported in antimicrobial 23 spectrum of pediocin on Bactibase. Recombinant pediocin is recorded to be stable to a wide range of 24 pH (1-12 for 1 hour) and temperature (100 o C for 15 min) as well as sensitive to protease treatment as Primer Sequence PedF CGCGGATCCGATGACGACGACAAGAAATATTATGGTAATGGTGTTA CCTGTGGTAAACATAGC PedR CCGCTCGAGCGGTTAACATTTATGATTACCCTGATGACCACC 60 DNA amplification product, after being treated by BamHI and XhoI restriction enzyme, 61 were then inserted into pET43.1a vector by T4 DNA ligase. The construction of pET43.1a 62 recombinant vector bearing ped gene denoted as pET43.1a -ped, was transformed into E. coli 126 by treating the purified pediocin respectively at 30, 50, 60, 70, 80, 90, 100 o C, 121 o C for 15 127 min. 128 The antimicrobial activity of pediocin was determined by agar diffusion test against the 129 indicator strain Listeria monocytogenes ATCC 13932. 130 Result 131 Construction of expression vector 132 Since pediocin is naturally produced in Pediococcus acidilactici, for expressing 133 recombinant pediocin in E. coli system, the DNA coding sequence of pediocin was analyzed 134 by Genscript Rare Codon Analysis tool in order to find out and optimize non-adaptable codons.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
customersupport@researchsolutions.com
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
This site is protected by reCAPTCHA and the Google Privacy Policy and Terms of Service apply.
Copyright © 2025 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.