Tomatoes (Solanum lycopersicum) represent one of the most frequently consumed vegetables in Mauritius after potatoes and onions. The value of the tomato industry is estimated to be around Rs 300 M in Mauritius, with an annual production of 18,376 t over an area of 1365 ha. (Cheung Kai Suet 2019). In August 2019, disease surveillance was conducted in the tomato cv. ‘Elipida’ grown in the greenhouse situated at Camp Thorel (eastern part of Mauritius), a super-humid zone where the prevailing temperature and humidity were 30°C and 70% respectively. The symptoms included numerous circular to irregular, dark brown, target like lesions on the leaves, followed by the occurrence of yellow halo and occasional defoliation. Disease incidence was estimated to be 80% in the entire greenhouse. From sampled symptomatic leaves, small pieces of infected tissue were surface-disinfected with 1% sodium hypochlorite, air dried, and placed on PDA. After 7 days incubation at 23°C under 12 hours of natural light regime, isolates with fast growing grey-brown, velvety colonies were recovered. In colonies, singly-borne or in short chains, pale brown, cylindrical, straight or slightly curved conidia with 2 – 14 pseudosepta (34 x 2 μm) were numerous. Based on morphological features, the isolates were identified as Corynespora cassiicola (Berk. and M.A. Curtis) C.T. Wei (Dixon et al. 2009). Morphological identification was confirmed by amplifying and sequencing of the ITS region (ITS1, 5.8S rDNA and ITS2 regions) of the rDNA. Total DNA was extracted directly from fungal mycelium using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany), following the manufacturer's instructions. PCR amplification and sequencing were performed with primers ITS1F and ITS4 (Takamatsu et al. 2010). The nucleotide sequence of the representative isolate 408G-19/M (575 bp) (Accession No. MN860167) was compared with those available in GenBank and shared 98 to 99.82% identity with over 100 C. cassiicola isolates (99.65% with FJ852578 from Solanum melongena, Dixon et al. 2009). Koch’s postulates were confirmed by spraying 10 healthy tomato plants (four leaf phenophase) with spore suspension (1 x 103 conidia/ml) prepared from 10 days old colonies of isolate 408G-19/M in sterile water. Healthy tomato plants inoculated with sterile water served as negative control. Plants were maintained in greenhouse conditions. On all inoculated plants, characteristic target like necrotic spots were visible 7 days post inoculation. No symptoms were recorded in the negative control after 15 days. From all symptomatic tomato leaves, the original isolate was successfully recovered. So far in Mauritius, C. cassiicola had been reported on Molucella (Anon. [Director of Agriculture] 1961) and Bignonia spp. (Orieux 1959) and also as an endophyte associated with Jatropha spp. (Rampadarath et al. 2018). Although symptoms resembling target spot were previously observed on field-grown tomatoes (Vally, pers. Comm.), to our knowledge, this is the first study confirming C. cassiicola as a tomato pathogen in Mauritius. As C. cassiicola affects a wide range of hosts (Lopez et al. 2018), including tomato, cucumber, zucchini and banana which are all important for Mauritius, the occurrence of this pathogen is a potential threat. Additionally, the results will help in developing efficient disease control strategies, thus minimizing yield loss of tomatoes produced locally.

BACKGROUND Animal manure frequently harbors pathogenic microorganisms such as Salmonella spp. and diarrheagenic Escherichia coli. A defined microbial consortium such as effective microorganisms (EM) can potentially be used as a biocontrol against manure‐borne human pathogens such as Salmonella and pathogenic E. coli. The objective of the study was to investigate the efficacy of EM to decontaminate cattle manure. RESULTS EM was first characterized by enumeration and identification of lactic acid bacteria (LAB), yeasts, actinomycetes and phototrophic bacteria (PB). The population density of LAB, yeasts, actinomycetes and presumptive PB was 6.9, 5.2, 5.9 and 3.9 log CFU g−1 respectively. LAB and yeast isolates were molecularly confirmed as Lactobacillus plantarum and L. casei (LAB) and Yarrowia lipolytica, Rhodotorula mucilaginosa and Picha manshurica (yeasts) respectively. Culture‐independent molecular analysis revealed the presence of additional species including L. parabuchneri and Enterococcus faecium (LAB) and bacterial spore‐formers Bacillus cereus and Clostridium spp. Application of EM to fresh cattle manure, inoculated with ~5–6 log CFU g−1 of antibiotic‐resistant strain of indicator organism E. coli ATCC 25922, resulted in complete elimination of the organism in 20 days, while survivors were still detected in the untreated counterpart. CONCLUSION EM can potentially be used for sustainable pathogen control in cattle manure for enhanced food safety and environmental health. © 2020 Society of Chemical Industry

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

No abstract

Water supply from La Ferme impounding reservoir is primarily intended for agricultural use. Unfortunately, there is a concern that the reservoir water is potentially befouled by agrochemicals and pollutants from nearby farms, feeder canals and a solid waste transfer station. The nutrient influx into La Ferme could favour the growth of toxin-producing cyanobacteria which could eventually jeopardize human and animal health. This research is aimed at assessing the water quality of La Ferme reservoir. Water was sampled at the intake tower and two rivers that discharge into La Ferme during summer/rainy (November–April) and winter/dry (June–September) seasons. The mean cyanobacterial count and level of orthophosphate, nitrate and total organic carbon in the reservoir were 63,738 cells/mL, 0.065 mg/L, 0.125 mg/L and 4.8 ppm, respectively. Orthophosphate and total organic carbon levels were significantly positively correlated with cyanobacterial cell counts. The mean orthophosphate level in reservoir water was found to be significantly higher (p ≤ 0.05) during rainy seasons (0.08 mg/L) compared to dry seasons (0.04 mg/L). Residues of herbicide tebuthiuron and cyanotoxin microcystin-LR were also detected with a mean concentration of 0.15 and 0.3 mg/L, respectively. This study highlights the potential eutrophic status of La Ferme reservoir and contamination of its watersheds by microalgal toxin and herbicide that could compromise the ecological integrity of the reservoir and negatively impact the sustainable use of this natural resource.