This novel PCR assay allows reliable identification of MRSA carriers in <1 h. This test should facilitate the efficacy of MRSA surveillance programs.

False positive blood culture results generate unnecessary hospitalizations, antibiotic therapy and use of microbiologic tests.

The presence of Enterococcus-associated vancomycin resistance genes vanA, vanB, vanD, vanE, and vanG in rectal swabs was investigated in two hospitals using PCR. All vanA genes detected were associated with vancomycin-resistant enterococci (VRE), whereas VRE-associated vanB genes were detected in only one hospital (4.7%). However, in both hospitals, high prevalences of vanB (6.2 and 2.3%), vanD (43.8 and 26.7%), and vanG (10.5 and 6.9%) genes not associated with enterococci were found.Since their first appearance in 1988, vancomycin-resistant enterococci (VRE) have emerged worldwide and have become an increasing problem in clinical settings (5). Acquired glycopeptide resistance in Enterococcus species is due to the acquisition of vanA, vanB, vanD, vanE, and vanG genes, resulting in the production of peptidoglycan precursors with reduced affinity for glycopeptide antibiotics (7). The origin of these van genes is still unknown, but recent studies have indicated that vanB resistance in enterococci might arise from gene transfer from the human bowel flora (1)(2)(3)6). In this study, we investigated the presence of Enterococcus-associated vanA, vanB, vanD, vanE, and vanG genes in human rectal swabs.Two rectal swabs each obtained from 162 patients at the Hôpital Général de Montréal (HGM) (Montréal, Québec, Canada) and one rectal swab each obtained from 86 patients at the Massachusetts General Hospital (MGH) (Boston, Mass.) were used to detect van-associated enterococci. One of the two swabs from each patient at HGM and each swab from MGH were suspended in 1 ml of buffer, and 50 l of this suspension was used for DNA extraction as previously described (4). Conventional PCR amplifications were performed with crude DNA extracts prepared from each rectal swab using primer pairs specific to vanA (forward, AATAGCGCGGACGAA TTGGAC; reverse, AACGCGGCACTGTTTCCCAA), vanB (forward, CTTAACGCTGCGATAGAAGC; reverse, CTG ATGGATGCGGAAGATAC), vanD (forward, TTTGTA AAGCCTGCCCGTTC; reverse, CCAAGTAYCCGGTAA ATCTTC), vanE (forward, AAATAATGCTCCATCAAT TTGCTGA; reverse, ATAGTCGAAAAAGCCATCCAC AAG), or vanG (forward, TTGGAGGCAATTCAACAG AGT; reverse, TCGCAGCCAACAACAGGTATT) genes. The PCR conditions were as previously described (4), except for the annealing temperatures, which varied from 58°C to 60°C depending on the van-specific primers used. Coamplification of a 250-bp fragment of plasmid M13pSL3 served as an internal control in all PCRs (4). Strict precautions to prevent carryover of amplified DNA and appropriate control reactions were used (4). The detection limit for each primer pair was approximately 5 genome copies per PCR.To recover van-associated enterococcal isolates from rectal swabs, a 300-l aliquot of the swab suspension was used to inoculate 10 ml of Enterococcosel broth (Becton Dickinson, Cockeysville, MD) containing 6 mg/liter vancomycin and 60 mg/liter aztreonam (EBVA), which was incubated aerobically for 24 h at 35°C. The other swab from each patient at HGM was placed directly into 10 ml of EBVA and incubated for 24 h at 35°C. ...