SummaryEthylene is a plant hormone that regulates many aspects of growth and development. Despite the well-known association between ethylene and stress signalling, its effects on stomatal movements are largely unexplored. Here, genetic and physiological data are provided that position ethylene into the Arabidopsis guard cell signalling network, and demonstrate a functional link between ethylene and hydrogen peroxide (H 2 O 2 ). In wild-type leaves, ethylene induces stomatal closure that is dependent on H 2 O 2 production in guard cells, generated by the nicotinamide adenine dinucleotide phosphate hydrogen (NADPH) oxidase AtrbohF. Ethyleneinduced closure is inhibited by the ethylene antagonists 1-MCP and silver. The ethylene receptor mutants etr1-1 and etr1-3 are insensitive to ethylene in terms of stomatal closure and H 2 O 2 production. Stomata of the ethylene signalling ein2-1 and arr2 mutants do not close in response to either ethylene or H 2 O 2 but do generate H 2 O 2 following ethylene challenge. Thus, the data indicate that ethylene and H 2 O 2 signalling in guard cells are mediated by ETR1 via EIN2 and ARR2-dependent pathway(s), and identify AtrbohF as a key mediator of stomatal responses to ethylene.

The promoters of wheat, barley and wild oat alpha-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56-58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4-5-C-X22-23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins.

No abstract

BackgroundStomatal guard cells monitor and respond to environmental and endogenous signals such that the stomatal aperture is continually optimised for water use efficiency. A key signalling molecule produced in guard cells in response to plant hormones, light, carbon dioxide and pathogen-derived signals is hydrogen peroxide (H2O2). The mechanisms by which H2O2 integrates multiple signals via specific signalling pathways leading to stomatal closure is not known.Principal FindingsHere, we identify a pathway by which H2O2, derived from endogenous and environmental stimuli, is sensed and transduced to effect stomatal closure. Histidine kinases (HK) are part of two-component signal transduction systems that act to integrate environmental stimuli into a cellular response via a phosphotransfer relay mechanism. There is little known about the function of the HK AHK5 in Arabidopsis thaliana. Here we report that in addition to the predicted cytoplasmic localisation of this protein, AHK5 also appears to co-localise to the plasma membrane. Although AHK5 is expressed at low levels in guard cells, we identify a unique role for AHK5 in stomatal signalling. Arabidopsis mutants lacking AHK5 show reduced stomatal closure in response to H2O2, which is reversed by complementation with the wild type gene. Over-expression of AHK5 results in constitutively less stomatal closure. Abiotic stimuli that generate endogenous H2O2, such as darkness, nitric oxide and the phytohormone ethylene, also show reduced stomatal closure in the ahk5 mutants. However, ABA caused closure, dark adaptation induced H2O2 production and H2O2 induced NO synthesis in mutants. Treatment with the bacterial pathogen associated molecular pattern (PAMP) flagellin, but not elf peptide, also exhibited reduced stomatal closure and H2O2 generation in ahk5 mutants.SignificanceOur findings identify an integral signalling function for AHK5 that acts to integrate multiple signals via H2O2 homeostasis and is independent of ABA signalling in guard cells.

No abstract