CD4+ T helper cells acquire effector phenotypes that promote specialized inflammatory responses. We show that the ETS family transcription factor, PU.1 was required for the development of an interleukin 9 (IL-9)-secreting subset of TH cells. Decreasing PU.1 expression either by conditional deletion in murine T cells or siRNA in human T cells impaired IL-9 production, while ectopic PU.1 expression promoted IL-9 production. Mice with PU.1-deficient T cells developed normal TH2 responses in vivo, but exhibited attenuated allergic pulmonary inflammation corresponding to decreased Il9 and chemokine expression in peripheral T cells and in lungs as compared to wild-type mice. Together, these data suggest a critical role for PU.1 in generating the TH9 phenotype and in the development of allergic inflammation.

IL-9 was first described in the late 1980s as a member of a growing number of cytokines that had pleiotropic functions in the immune system. Although many biological functions have been attributed to IL-9, it remains an understudied cytokine. A resurgence of interest in IL-9 has been spurred by recent work demonstrating a role for IL-9 in regulating inflammatory immunity and defining the transcription factors that activate the Il9 gene in cells that most efficiently produce IL-9. In this review, we summarize the characterization of IL-9 biological activities, highlight roles for the cytokine that are clearly defined, and outline questions regarding IL-9 functions that still require further exploration.

T helper 9 (Th9) cells are specialized for the production of IL-9, promote allergic inflammation in mice, and are associated with allergic disease in humans. It has not been determined whether Th9 cells express a characteristic transcriptional signature. In this study, we performed microarray analysis to identify genes enriched in Th9 cells compared with other Th subsets. This analysis defined a transcriptional regulatory network required for the expression of a subset of Th9-enriched genes. The activator protein 1 (AP1) family transcription factor BATF (B cell, activating transcription factor-like) was among the genes enriched in Th9 cells and was required for the expression of IL-9 and other Th9-associated genes in both human and mouse T cells. The expression of BATF was increased in Th9 cultures derived from atopic infants compared with Th9 cultures from control infants. T cells deficient in BATF expression had a diminished capacity to promote allergic inflammation compared with wild-type controls. Moreover, mouse Th9 cells ectopically expressing BATF were more efficient at promoting allergic inflammation than control transduced cells. These data indicate that BATF is a central regulator of the Th9 phenotype and contributes to the development of allergic inflammation.

T helper cell effector subsets develop in response to specific cytokine environments. The development of a particular cytokine-secreting pattern requires an integration of signals that may promote the development of opposing pathways. A recent example of this paradigm is the IL-9-secreting Th9 cell that develops in response to TGFβ and IL-4, cytokines that in isolation promote the development of iTregs and Th2 cells, respectively. To determine how the balance of these factors results in priming for IL-9 secretion, we examined the effects of each pathway on transcription factors that regulate T helper cell differentiation. We demonstrate that TGFβ induces the PU.1-encoding Sfpi1 locus and that this is independent of IL-4-induced STAT6 activation. IL-4-activated STAT6 is required for repressing the expression of T-bet and Foxp3 in Th9 cells, transcription factors that inhibit IL-9 production, and is required for the induction of IRF4, which promotes Th9 development. These data establish a transcription factor network that regulates IL-9, and demonstrates how combinationsof cytokine signals generate cytokine-secreting potential by altering the expression of a panel of transcription factors.

Cells were seeded in 24-well plates and stimulated with CPE or soy extract. Cells were recovered at several time points for RNA isolation with the RNeasy Mini Kit (Qiagen).Bone marrow-derived DCs. Bone marrow cells were collected from femurs and cultured for 10 days in RPMI 1640 with l-glutamine (Gibco, Life Technologies), supplemented with 10% fetal bovine serum (Gemini Bio-products), penicillin/streptomycin (Gibco, Life Technologies), 50 μM 2-Mercaptoethanol (Sigma-Aldrich), and 20 ng/ml GM-CSF (Peprotech). At day 10, bone marrow-derived DCs were collected and resuspended in complete RPMI at a concentration of 5 × 10 5 cells per ml. Cells were stimulated for 3 hours with CPE (50 μg/ml), followed by RNA isolation with the RNeasy Mini Kit (Qiagen).Real-time PCR. RT-PCR was performed, starting from 1 μg total RNA, using SuperScript II Reverse Transcriptase (Invitrogen, Life Technologies). cDNA was amplified using the Power SYBR Green PCR Master Mix (Applied Biosystems, Life Technologies) and run on an Applied Biosystems 7300 Real-Time Detection System, using the following primers: mouse Il6, F, TTCCATCCAGTTGCCTTCTTG; R, GGGAGTGGTATCCTCTGTGAAGTC; mouse Il1b (65), F, TTGACGGACCCCAAAAGAT; R, GAGCGCTCACGAACAGTTG; mouse Il10 (25), F, TGCTATGCTGCCTGCTCTTA; R, TCATTTC-CGATAAGGCTTGG; mouse Ox40l (25), F, CCCTCCAATCCAAA-GACTCA; R, ATCCTTCGACCATCGTTCAG; mouse Il33, F, ATC-GGGTACCAAGCATGAAG; R, GACTTGCAGGACAGGGAGAC; mouse Tslp (48), F, GAGAGAAATGACGGTACTCA; R, CTACAGT-TAGGTTTGCCCTA; mouse Il25, F, TGTTGCATTCTTGGCAAT-GATC; R, GACTGCAGCCCTCCTGGAT; human IL6, F, AAA-GAGGCACTGGCAGAAAA; R, CAGGGGTGGTTATTGCATCT; human IL33, F, GAGCTAAGGCCACTGAGGAA; R, TGGGCCTTT-GAAGTTCCATA.GADPH and β-actin were used as the housekeeping genes. Relative quantification was performed using the comparative threshold cycle method (2 -ΔΔCt ). The changes in gene expression were calculated with respect to the untreated cells. All amplifications were carried out in duplicates. Antigen presentation assay. Antigen presentation assay was performed as previously described (19). BALB/c mice were exposed to 10 mg OVA in the presence or absence of 1 mg CPE. After 24 hours, DCs were purified from inguinal lymph nodes by using CD11c microbeads (Miltenyi Biotec). DCs were cultured at a ratio of 1:5 with DO11.10 CD4 + T cells. After 72 hours, cells were restimulated with anti-CD3/CD28, supernatants were harvested, and cytokines were measured by ELISA according to manufacturer's instructions (all from eBioscience).In neutralization experiments, anti-ST2 was injected prior to exposure with OVA and CPE, as described above. For the OX40L neu- The Journal of Clinical InvestigationR e s e a R c h a R t i c l e 4 9 7 4