The G-quadruplex (GQ) is a well-studied non-canonical DNA structure formed by G-rich sequences found at telomeres and gene promoters. Biological studies suggest that GQs may play roles in regulating gene expression, DNA replication, and DNA repair. Small molecule ligands were shown to alter GQ structure and stability and thereby serve as novel therapies, particularly against cancer. In this work, we investigate the interaction of a G-rich sequence, 5’-GGGTTGGGTTGGGTTGGG-3’ (T1), with a water-soluble porphyrin, N-methyl mesoporphyrin IX (NMM) via biophysical and X-ray crystallographic studies. UV-vis and fluorescence titrations, as well as a Job plot, revealed a 1:1 binding stoichiometry with an impressively tight binding constant of 30–50 μM-1 and ΔG298 of -10.3 kcal/mol. Eight extended variants of T1 (named T2 –T9) were fully characterized and T7 was identified as a suitable candidate for crystallographic studies. We solved the crystal structures of the T1- and T7-NMM complexes at 2.39 and 2.34 Å resolution, respectively. Both complexes form a 5’-5’ dimer of parallel GQs capped by NMM at the 3’ G-quartet, supporting the 1:1 binding stoichiometry. Our work provides invaluable details about GQ-ligand binding interactions and informs the design of novel anticancer drugs that selectively recognize specific GQs and modulate their stability for therapeutic purposes.

Six high molecular weight, soluble, and stable elastomers were prepared derived from −O­(CH2)3Si­(CH3)3/–OCH2CF3 cosubstituted polyphosphazenes with 1–92 mol % of the organosilicon component. The surface and morphological properties are appropriate for biomaterials, soft contact printing, or other elastomeric applications. Full substitution by either side group yields thermoplastics. The syntheses were facilitated by small molecule model reactions to establish appropriate reaction conditions.

An i‐motif is a non‐canonical DNA structure implicated in gene regulation and linked to cancers. The C‐rich strand of the HRAS oncogene, 5′‐CGCCCGTGCCCTGCGCCCGCAACCCGA‐3′ (herein referred to as iHRAS), forms an i‐motif in vitro but its exact structure was unknown. HRAS is a member of the RAS proto‐oncogene family. About 19 % of US cancer patients carry mutations in RAS genes. We solved the structure of iHRAS at 1.77 Å resolution. The structure reveals that iHRAS folds into a double hairpin. The two double hairpins associate in an antiparallel fashion, forming an i‐motif dimer capped by two loops on each end and linked by a connecting region. Six C−C+ base pairs form each i‐motif core, and the core regions are extended by a G−G base pair and a cytosine stacking. Extensive canonical and non‐canonical base pairing and stacking stabilizes the connecting region and loops. The iHRAS structure is the first atomic resolution structure of an i‐motif from a human oncogene. This structure sheds light on i‐motifs folding and function in the cell.

G-quadruplexes (GQs) are non-canonical DNA structures composed of stacks of stabilized G-tetrads. GQs play an important role in a variety of biological processes and may form at telomeres and oncogene promoters among other genomic locations. Here, we investigate nine variants of telomeric DNA from Tetrahymena thermophila with the repeat (TTGGGG)n. Biophysical data indicate that the sequences fold into stable four-tetrad GQs which adopt multiple conformations according to native PAGE. Excitingly, we solved the crystal structure of two variants, TET25 and TET26. The two variants differ by the presence of a 3′-T yet adopt different GQ conformations. TET25 forms a hybrid [3 + 1] GQ and exhibits a rare 5′-top snapback feature. Consequently, TET25 contains four loops: three lateral (TT, TT, and GTT) and one propeller (TT). TET26 folds into a parallel GQ with three TT propeller loops. To the best of our knowledge, TET25 and TET26 are the first reported hybrid and parallel four-tetrad unimolecular GQ structures. The results presented here expand the repertoire of available GQ structures and provide insight into the intricacy and plasticity of the 3D architecture adopted by telomeric repeats from T. thermophila and GQs in general.

No abstract