Precise control over the nucleation, growth, and termination of self-assembly processes is a fundamental tool for controlling product yield and assembly dynamics. Mechanisms for altering these processes programmatically could allow the use of simple components to self-assemble complex final products or to design processes allowing for dynamic assembly or reconfiguration. Here we use DNA tile self-assembly to develop general design principles for building complexes that can bind to a growing biomolecular assembly and terminate its growth by systematically characterizing how different DNA origami nanostructures interact with the growing ends of DNA tile nanotubes. We find that nanostructures that present binding interfaces for all of the binding sites on a growing facet can bind selectively to growing ends and stop growth when these interfaces are presented on either a rigid or floppy scaffold. In contrast, nucleation of nanotubes requires the presentation of binding sites in an arrangement that matches the shape of the structure's facet. As a result, it is possible to build nanostructures that can terminate the growth of existing nanotubes but cannot nucleate a new structure. The resulting design principles for constructing structures that direct nucleation and termination of the growth of one-dimensional nanostructures can also serve as a starting point for programmatically directing two- and three-dimensional crystallization processes using nanostructure design.

Metrics & MoreArticle RecommendationsI n Supporting Information, on page 9, the sequences of the two RT A seed adapter strands, "A-4bp-5_6REd_2: TGGTTGCTCGTGCTTGGCTGGCAT" and "A-4bp-9_10SRd_2: TGGTTGCTCGTGCTTGGCTGGCAT", are incorrect.These two sequences should be replaced with "A-4bp-5_6REd_2: TGGTTCGTCCGCTGGCTCTGGCAT" and "A-4bp-9_10SRd_2: TGGTTCAGGCTTGACGGTTGG-CAT". This erratum does not affect any of the experimental results, discussions, or conclusions reported in the paper. The authors sincerely apologize for this oversight.