No abstract

Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether T3 regulates the mouse SREBP-1c mRNA expression. We found that T3 negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by ribonuclease protection assays and real-time quantitative RT-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1-6 cells revealed that T3 negatively regulates the mouse SREBP-1c gene promoter (-574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T3. Gel shift assays showed that retinoid X receptor-alpha/thyroid hormone receptor-beta heterodimer bound to Site2, but retinoid X receptor-alpha/liver X receptor- heterodimer could not bind to the site. In vivo chromatin immunoprecipitation assays demonstrated that T3 induced thyroid hormone receptor-beta recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T3 in vivo and that T3 negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element: Site2.

The molecular mechanism of thyroid hormone (TH) effects to fatty acid metabolism in liver is yet to be clear. The carbohydrate response element-binding protein (ChREBP) as well as sterol response element-binding protein (SREBP)-1c plays a pivotal role in hepatic lipogenesis. Both SREBP-1c and ChREBP are target genes of liver X receptors (LXRs). Because LXRs and TH receptors (TRs) cross talk mutually in many aspects of transcription, we examined whether TRs regulate the mouse ChREBP gene expression. In the current study, we demonstrated that TH up-regulated mouse ChREBP mRNA and protein expression in liver. Run-on and luciferase assays showed that TH and TR-beta1 positively regulated the ChREBP gene transcription. The mouse ChREBP gene promoter contains two direct repeat-4 sites (LXRE1 and LXRE2) and EMSAs demonstrated that LXR-alpha and TR-beta1 prefer to bind LXRE1 and LXRE2, respectively. The direct repeat-4 deletion and LXRE2 mutants of the promoter deteriorate the positive regulation by TR-beta1, indicating that LXRE2 is functionally important for the regulation. We also showed that human ChREBP gene expression and promoter activities were up-regulated by TH. These data suggest that ChREBP mRNA expression is positively regulated by TR-beta1 and TH at the transcriptional level in mammals. This novel observation indicates that TH fine-tunes hepatic lipogenesis via regulating SREBP-1c and ChREBP gene expression reciprocally.

No abstract

The nuclear oxysterol receptors, liver X receptors (LXRs), and thyroid hormone receptors (TRs) cross talk mutually in many aspects of transcription, sharing the same DNA binding site (direct repeat-4) with identical geometry and polarity. In the current study, we demonstrated that thyroid hormone (T3) up-regulated mouse LXR-α, but not LXR-β, mRNA expression in the liver and that cholesterol administration did not affect the LXR-α mRNA levels. Recently, several groups have reported that human LXR-α autoregulates its own gene promoter through binding to the LXR response element. Therefore, we examined whether TRs regulate the mouse LXR-α gene promoter activity. Luciferase assays showed that TR-β1 positively regulated the mouse LXR-α gene transcription. Analysis of serial deletion mutants of the promoter demonstrated that the positive regulation by TR-β1 was not observed in the −1240/+30-bp construct. EMSA(s) demonstrated that TR-β1 or retinoid X receptor-α did not bind to the region from −1300 to −1240 bp (site A), whereas chromatin-immunoprecipitation assays revealed that TR-β1 and retinoid X receptor-α were recruited to the site A, indicating the presence of intermediating protein between the nuclear receptors and DNA site. We also showed that human LXR-α gene expression and promoter activities were up-regulated by thyroid hormone. These data suggest that LXR-α mRNA expression is positively regulated by TR-β1 and thyroid hormone at the transcriptional level in mammals. This novel insight that thyroid hormone regulates LXR-α mRNA levels and promoter activity should shed light on a cross talk between LXR-α and TR-β1 as a new therapeutic target against dyslipidemia and atherosclerosis.