Neuropathic pain, which is accompanied by an unpleasant sensation, affects the patient’s quality of life severely. Considering the complexity of the neuropathic pain, there are huge unmet medical needs for it while current effective therapeutics remain far from satisfactory. Accordingly, exploration of mechanisms of neuropathic pain could provide new therapeutic insights. While numerous researches have pointed out the contribution of sensory neuron-immune cell interactions, other mechanisms of action, such as long non-coding RNAs (lncRNAs), also could contribute to the neuropathic pain observed in vivo. LncRNAs have more than 200 nucleotides and were originally considered as transcriptional byproducts. However, recent studies have suggested that lncRNAs played a significant role in gene regulation and disease pathogenesis. A substantial number of long non-coding RNAs were expressed differentially in neuropathic pain models. Besides, therapies targeting specific lncRNAs can significantly ameliorate the development of neuropathic pain, which reveals the contribution of lncRNAs in the generation and maintenance of neuropathic pain and provides a new therapeutic strategy. The primary purpose of this review is to introduce recent studies of lncRNAs on different neuropathic pain models.

Purpose Neuropathic pain is a chronic intractable disease characterized by allodynia and hyperalgesia. Effective treatments are unavailable because of the complicated mechanisms of neuropathic pain. Transient receptor potential canonical 6 (TRPC6) is a nonselective calcium (Ca 2+ )-channel protein related to hyperalgesia. Dexmedetomidine (Dex) is an alpha-2 (α2) adrenoreceptor agonist that mediates intracellular Ca 2+ levels to alleviate pain. However, the relationship between TRPC6 and Dex is currently unclear. We speculated that the α2 receptor agonist would be closely linked to the TRPC6 channel. We aimed to investigate whether Dex relieves neuropathic pain by the TRPC6 pathway in the dorsal root ganglia (DRG). Methods The chronic constriction injury (CCI) model was established in male rats, and we evaluated the mechanical withdrawal threshold (MWT) and thermal withdrawal latency (TWL). The expression of TRPC6 and Iba-1 in the DRG were analyzed using quantitative real-time polymerase chain reaction, Western blot, and immunofluorescence assay. The levels of inflammatory cytokines were measured using an enzyme-linked immunosorbent assay. Results Compared with the CCI normal saline group, both the MWT and TWL were significantly improved after 7 days of Dex administration. Results demonstrated that TRPC6 expression was increased in the DRG following CCI but was suppressed by Dex. In addition, multiple administrations of Dex inhibited the phosphorylation level of p38 mitogen-activated protein kinase and the upregulation of neuroinflammatory factors. Conclusion The results of this study demonstrated that Dex exhibits anti-nociceptive and anti-inflammatory properties in a neuropathic pain model. Moreover, our findings of the CCI model suggested that Dex has an inhibitory effect on TRPC6 expression in the DRG by decreasing the phosphorylation level of p38 in the DRG.

Limb weakness is an uncommon symptom in children, with multiple factors contributing to related diseases, particularly genetic disorders. A nine-year-old boy presented with slowly progressive muscle weakness of the limb-girdle muscles. We evaluated the clinical symptoms, laboratory tests, imaging examinations, and pathological examinations of this proband. We combined whole-exome and Sanger sequencing to identify the novel compound heterozygous pathogenic mutations NM 001849.3: c.1970-10_1978 del CGGCTTGCAGGGACGCGTG and c.2462-3C>A in COL6A2 in this proband inherited from the mother and father, respectively. Mutational confirmation at the mRNA level demonstrated that the proband carried a homozygous abnormal sequence with 23bp deletions (c.2462-2484 del GGACGCGTGTGGGCGTGGTGCAG) at the beginning of exon 26. In contrast, both parents and sibling have normal sequences with no clinical symptoms. The results of this study further expand the mutational spectrum and will be helpful for further molecular diagnosis.