Autosomal dominant polycystic liver disease results from mutations in PRKCSH or SEC63. The respective gene products, glucosidase IIβ and SEC63p, function in protein translocation and quality control pathways in the endoplasmic reticulum. Here we show that glucosidase IIα and Sec63p are required in mice for adequate expression of a functional complex of the polycystic kidney disease gene products, polycystin-1 and polycystin-2. We find that polycystin-1 is the rate-limiting component of this complex and that there is a dose-response relationship between cystic dilation and levels of functional polycystin-1 following mutation of Prkcsh or Sec63. Reduced expression of polycystin-1 also serves to sensitize the kidney to cyst formation resulting from mutations in Pkhd1, the recessive polycystic kidney disease gene. Finally, we show that proteasome inhibition increases steady-state levels of polycystin-1 in cells lacking glucosidase IIβ and that treatment with a proteasome inhibitor reduces cystic disease in orthologous gene models of human autosomal dominant polycystic liver disease.

SummaryCo-translational transport of polypeptides into the endoplasmic reticulum (ER) involves the Sec61 channel and additional components such as the ER lumenal Hsp70 BiP and its membrane-resident co-chaperone Sec63p in yeast. We investigated whether silencing the SEC61A1 gene in human cells affects co-and post-translational transport of presecretory proteins into the ER and post-translational membrane integration of tail-anchored proteins. Although silencing the SEC61A1 gene in HeLa cells inhibited co-and post-translational transport of signal-peptide-containing precursor proteins into the ER of semi-permeabilized cells, silencing the SEC61A1 gene did not affect transport of various types of tail-anchored protein. Furthermore, we demonstrated, with a similar knockdown approach, a precursor-specific involvement of mammalian Sec63 in the initial phase of co-translational protein transport into the ER. By contrast, silencing the SEC62 gene inhibited only post-translational transport of a signal-peptide-containing precursor protein.

In the original article, the RT-PCR primer sequences listed in Methods were incorrectly labeled as Pkd1. The correct primer sequences for Pkd1 are in the revised paragraph below. Quantitative PCR and reverse transcription PCR. RNA was isolated from cultured cells using Trizol Reagent (Invitrogen). cDNA was reverse transcribed from RNA using reagents from New England Biolabs. Primers for Pkd1 quantitative PCR (forward, GCTA-CAGGGCATCCTGGTG; reverse, GGCTGTCAGCGAGAGCTTGAA) were designed using NCBI's primer-designing tool (http://www. ncbi.nlm.nih.gov/tools/primer-blast/). Quantitative PCR was done by Bio-Rad CFX Connect Real-Time PCR Detection System. Primers for Xbp1 RT-PCR have been published previously (1).

No abstract

Autosomal dominant polycystic kidney disease (ADPKD) is the most common potentially lethal monogenic disorder, with more than 12 million cases worldwide. The two causative genes for ADPKD, PKD1 and PKD2, encode protein products polycystin-1 (PC1) and polycystin-2 (PC2 or TRPP2), respectively. Recent data have shed light on the role of PC1 in regulating the severity of the cystic phenotypes in ADPKD, autosomal recessive polycystic kidney disease (ARPKD), and isolated autosomal dominant polycystic liver disease (ADPLD). These studies showed that the rate for cyst growth was a regulated trait, a process that can be either sped up or slowed down by alterations in functional PC1. These findings redefine the previous understanding that cyst formation occurs as an “on-off” process. Here we review these and other related studies with an emphasis on their translational implications for polycystic diseases.