Ribosome biogenesis is facilitated by a growing list of assembly cofactors, including helicases, GTPases, chaperones, and other proteins, but the specific functions of many of these assembly cofactors are still unclear. The effect of three assembly cofactors on 30S ribosome assembly was determined in vitro using a previously developed mass spectrometry-based method that monitors the rRNA binding kinetics of ribosomal proteins. The essential GTPase Era caused several late-binding proteins to bind rRNA faster when included in a 30S reconstitution. RimM enabled faster binding of S9 and S19, and inhibited the binding of S12 and S13, perhaps by blocking those proteins' binding sites. RimP caused proteins S5 and S12 to bind dramatically faster. These quantitative kinetic data provide important clues about the roles of these assembly cofactors in the mechanism of 30S biogenesis.

No abstract

Listeria monocytogenes , a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes . The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δ lmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δ lmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.

The in vivo assembly of ribosomal subunits requires assistance by maturation proteins that are not part of mature ribosomes. One such protein, RbfA, associates with the 30S ribosomal subunits. Loss of RbfA causes cold sensitivity and defects of the 30S subunit biogenesis and its overexpression partially suppresses the dominant cold sensitivity caused by a C23U mutation in the central pseudoknot of 16S rRNA, a structure essential for ribosome function. We have isolated suppressor mutations that restore partially the growth of an RbfA-lacking strain. Most of the strongest suppressor mutations alter one out of three distinct positions in the carboxy-terminal domain of ribosomal protein S5 (S5) in direct contact with helix 1 and helix 2 of the central pseudoknot. Their effect is to increase the translational capacity of the RbfA-lacking strain as evidenced by an increase in polysomes in the suppressed strains. Overexpression of RimP, a protein factor that along with RbfA regulates formation of the ribosome's central pseudoknot, was lethal to the RbfA-lacking strain but not to a wild-type strain and this lethality was suppressed by the alterations in S5. The S5 mutants alter translational fidelity but these changes do not explain consistently their effect on the RbfA-lacking strain. Our genetic results support a role for the region of S5 modified in the suppressors in the formation of the central pseudoknot in 16S rRNA.

The RimM protein in Escherichia coli is important for the in vivo maturation of 30S ribosomal subunits and a ⌬rimM mutant grows poorly due to assembly and translational defects. These deficiencies are suppressed partially by mutations that increase the synthesis of another assembly protein, RbfA, encoded by the metYnusA-infB operon. Among these suppressors are mutations in nusA that impair the NusA-mediated negativefeedback regulation at internal intrinsic transcriptional terminators of the metY-nusA-infB operon. We describe here the isolation of two new mutations, one in rpoB and one in rpoC (encoding the ␤ and ␤ subunits of the RNA polymerase, respectively), that increase the synthesis of RbfA by preventing NusA from stimulating termination at the internal intrinsic transcriptional terminators of the metY-nusA-infB operon. The rpoB2063 mutation changed the isoleucine in position 905 of the ␤ flap-tip helix to a serine, while the rpoC2064 mutation duplicated positions 415 to 416 (valine-isoleucine) at the base of the ␤ dock domain. These findings support previously published in vitro results, which have suggested that the ␤ flap-tip helix and ␤ dock domain at either side of the RNA exit tunnel mediate the binding to NusA during transcriptional pausing and termination.The synthesis of ribosomes in bacteria such as Escherichia coli is highly efficient probably because of the action of ribosome maturation proteins that are not part of the mature ribosomal subunits. One of these, the RimM protein, binds to r-protein S19 in the 30S subunits (24) and also to S19 free in solution (46) and facilitates the incorporation of S19 during in vitro assembly of the 30S subunits (4). Mutants lacking RimM show a 7-fold-decreased growth rate and a reduced translational efficiency, resulting from a deficiency in the maturation of the 30S subunits (6, 7). Specific alterations in r-protein S13 or an increased expression of another ribosome maturation protein, RbfA, partially suppress the slow growth and translational deficiency of a ⌬rimM102 mutant (6, 7).RbfA is encoded by the metY-nusA-infB operon (Fig. 1), which contains, in the direction of transcription, the metY gene encoding a minor form of the initiator tRNA (19), the rimP gene (formerly p15a or yhbC) for the ribosome maturation protein RimP (19, 31), the nusA gene for the transcriptional elongation factor NusA (11, 18, 41), the infB gene encoding the translation initiation factor IF2 (35, 39), the rbfA gene (12, 43), and the truB gene for the tRNA ⌿55 synthase (32, 43). The metY-nusA-infB operon contains two promoters upstream from metY, P Ϫ1 (15) and P 1 (19,26), and a minor promoter, P 2 , located between metY and rimP (37). The cleavage by RNase III at sites between metY and rimP on the polycistronic mRNA initiates the rapid degradation of the downstream RNA (37). There are two rho-independent transcriptional terminators, T 1 (CCCCGATTTATCGGGGTTTTTT) and T 2 (GGGCTTTA GGCCCTTTTTTT), between metY and rimP (18, 37) and one, T 3 (GGGGCTAACAGCCCCTTTTT), between infB and rbfA...