In this work, we establish the use of surface-enhanced Raman scattering (SERS) as a label-free analytical technique for the direct detection of G-quadruplex formation. In particular, we demonstrate that SERS analysis allows the evaluation of the relative stability of G quadruplexes that differ for the number of G tetrads and investigate several structural features of quadruplexes, such as the orientation of glycosidic bonds, the identification of distortions in the sugar-phosphate backbone, and the degree of hydrogen-bond solvation. Herein, the fluctuation of the SERS spectra, due to the specific interaction of vibrational modes with the SERS-active substrate, is quantitatively analyzed before and after quadruplex formation. The results of this study suggest a perpendicular orientation of the quadruplexes (with or without the 3'-tetra end linker) with respect to the silver colloidal surface, which opens new perspectives for the use of SERS as a label-free analytical tool for the study of the binding mode between quadruplexes and their ligands.

An acyclic pyrimidine analogue, containing a five-member cycle fused on the pyrimidine ring, was synthesized and introduced at position 7 or 12 of the 15-mer oligodeoxynucleotide GGTTGGTGTGGTTGG, known as thrombin-binding aptamer (TBA). Characterization by 1H NMR and CD spectroscopies of the resulting aptamers, TBA-T7b and TBA-T12b, showed their ability to fold into the typical antiparallel chairlike G-quadruplex structure formed by TBA. The apparent CD melting temperatures indicated that the introduction of the acyclic residue, mainly at position 7, improves the thermal stability of resulting G-quadruplexes with respect to TBA. The anticoagulant activity of the new molecules was then valued in PT assay, and it resulted that TBA-T7b is more potent than TBA in prolonging clotting time. On the other hand, in purified fibrinogen assay the thrombin inhibitory activity of both modified sequences was lower than that of TBA using human enzyme, whereas the potency trend was again reversed using bovine enzyme. Obtained structure-activity relationships were investigated by structural and computational studies. Taken together, these results reveal the active role of TBA residues T7 and T12 and the relevance of some amino acids located in the anion binding exosite I of the protein in aptamer-thrombin interaction.

Computational techniques, and in particular molecular dynamics (MD) simulations, have been successfully used as a complementary technique to predict and analyse the structural behaviour of nucleic acids, including peptide nucleic acid- (PNA-) RNA hybrids. This study shows that a 7-base long PNA complementary to the seed region of miR-509-3p, one of the miRNAs involved in the posttranscriptional regulation of the CFTR disease-gene of Cystic Fibrosis, and bearing suitable functionalization at its N- and C-ends aimed at improving its resistance to nucleases and cellular uptake, is able to revert the expression of the luciferase gene containing the 3′UTR of the gene in A549 human lung cancer cells, in agreement with the MD results that pointed at the formation of a stable RNA/PNA heteroduplex notwithstanding the short sequence of the latter. The here reported results widen the interest towards the use of small PNAs as effective anti-miRNA agents.

The combined use of silanes (Et3SiH or PMHS) and I2 as novel N-glycosidation reagents for the synthesis of bioactive oxathiolane nucleosides 3TC and FTC is reported. Both systems (working as anhydrous HI sources) were devised to act as substrate activators and N-glycosidation promoters. Excellent results in terms of chemical efficiency and stereoselectivity of the reactions were obtained; surprisingly, the nature of the protective group at the N4 position of (fluoro)cytosine additionally influenced the stereochemical reaction outcome.

The cKit87up sequence d((5')AGGGAGGGCGCTGGGAGGAGGG(3')) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a small library of PNA probes (P1-P5) targeting cKit87up quadruplex in either K(+)- or NH(4)(+)-containing solutions by using a combination of UV, CD, PAGE, ITC, and ESI-MS methodologies. Our results showed that (1) P1-P4 interact with the cKit87up quadruplex, and (2) the binding mode depends on the quadruplex stability. In K(+) buffer, P1-P4 bind the ckit87up quadruplex structure as "quadruplex-binding agents". The same holds for P1 in NH(4)(+) solution. On the contrary, in NH(4)(+) solution, P2-P4 overcome the quadruplex structure by forming PNA/DNA hybrid complexes, thus acting as "quadruplex openers".