A stop codon at position 322 was introduced to generate a truncated, C-terminal-deleted AT2 receptor. Expression studies in Xenopus oocytes showed that C-terminal-deleted AT2 had reduced a⁄nity to [ 125 I]angiotensin II (K d = 1.7 nM) and enhanced binding of the AT2-speci¢c peptidic ligand [ 125 I]CGP42112A (K d = 0.097 nM). AT2 activation by angiotensin II resulted in reduction of cGMP levels in oocytes and this reduction was further enhanced by C-terminal deletion, implying that the C-terminus may have a negative e¡ect on the AT2-mediated cGMP reduction. Moreover, interaction of the AT2 with the ATP-binding domain of the human ErbB3 receptor in yeast two-hybrid assay was abolished by C-terminal deletion. In summary, the C-terminal cytoplasmic tail of AT2 modulates its ligand binding and signaling properties. ß

Analysis of transcript levels by reverse transcriptasequantitative PCRMEFs of the indicated genotypes were cultured in parallel at a density of 200,000/ml. The MEFs were infected with 200 HA units/ml Sendai virus (Charles River Laboratories, Wilmington, MA). mRNA was isolated using the RNeasy Kit (Qiagen), reverse transcribed using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics) and quantified by quantitative PCR (qPCR) using a Bio-Rad Thermal Cycler with Roche SYBR Green Master Mix and the following primers: Ifnb1 (CACAGCCCTCTCCATCAACTA, CATT TCCGAATGTTCGTCCT), Tnf (TTGTCTTAATAACGCTGATTTGGT, GGGAGCAGAGGTTCAGTGAT), Il6 (TGCCTTCATTTATCCCTTGAA, TTACTACATTCAGCCAAAAAGCAC), M (TGGTGCTCCACTCCTACCAT, GTGCGACCTTGTTTGCATTA), and H3f3a (GCCATCTTTCAATTGTGT TCG, AGCCATGGTAAGGACACCTC). Analysis of protein binding to specific chromatin regions by chromatin immunoprecipitation qPCRMEFs were cultured as indicated in the previous section. Chromatin was prepared from the MEFs and immunoprecipitated with 24 mg of the indicated Abs. The precipitated DNA was isolated and quantified by qPCR using the primers: Ifnb1 (ATTCCTCTGAGGCAGAAAGGACCA, GCAAGATGAGG-CAAAGGCTGTCAA), Tnf (AACCCTCTGCCCCCGCGATG, TCCTCGCT GAGGGAGCTTCTGC), Il6 (TGGGGATGTCTGTAGCTCATT, GGAACT GCCTTCACTTACTTGC), Ifnb1 10 kb (TCCTGCAGCATTCGTACAAG, CATTCCTCTCTCCCCTTGC), Ifnb1 150 kb (TTTCTGTTTTCTGTCGG ATCAC, ACCAATAGCGTTGAGAGACCA).

BACKGROUND AND PURPOSETo further the development of new agents for the treatment of adrenocortical carcinoma (ACC), we characterized the molecular and cellular mechanisms of cytotoxicity by the adrenalytic compound ATR-101 (PD132301-02). EXPERIMENTAL APPROACHWe compared the effects of ATR-101, PD129337, and ABC transporter inhibitors on cholesterol accumulation and efflux, on cortisol secretion, on ATP levels, and on caspase activation in ACC-derived cell lines. We examined the effects of these compounds in combination with methyl-β-cyclodextrin or exogenous cholesterol to determine the roles of altered cholesterol levels in the effects of these compounds. KEY RESULTSATR-101 caused cholesterol accumulation, ATP depletion, and caspase activation within 30 minutes after addition to ACC-derived cells, whereas PD129337 did not. Suppression of cholesterol accumulation by methyl-β-cyclodextrin or exogenous cholesterol, prevented ATP depletion and caspase activation by ATR-101. ATR-101 blocked cholesterol efflux and cortisol secretion, suggesting that it inhibited ABCA1, ABCG1, and MDR1 transporters. Combinations of ABCA1, ABCG1, and MDR1 inhibitors were also cytotoxic. Combinations of ATR-101 with inhibitors of ABCG1, MDR1, or mitochondrial functions had increased cytotoxicity. Inhibitors of steroidogenesis reduced ATP depletion by ATR-101, whereas U18666A enhanced cholesterol accumulation and ATP depletion together with ATR-101. ATR-101 repressed ABCA1, ABCG1, and IDOL transcription by mechanisms that were distinct from the mechanisms that caused cholesterol accumulation. CONCLUSIONS AND IMPLICATIONSInhibition of multiple ABC transporters and the consequent accumulation of cholesterol mediated the cytotoxicity of ATR-101. Compounds that replicate these effects in tumours are likely to be useful in the treatment of ACC. IntroductionControl of the levels of cholesterol (The term "cholesterol" is used to denote unesterified cholesterol in this paper) is essential for cell functions and viability (see Maxfield and Van Meer, 2010). The cholesterol levels in adrenocortical cells are affected by many pathways, some of which are unique to the adrenal cortex. Studies of anti-atherosclerosis agents have identified compounds that cause selective degeneration of the adrenal cortex (adrenalytic activity) in several species (Dominick et al., 1993;Reindel et al., 1994;Matsuo et al., 1996;Sliskovic et al., 1998;Tanaka et al., 1998). Here we have investigated the adrenalytic compound ATR-101, also known as PD132301-02, as a prospective agent for the treatment of adrenocortical carcinoma (ACC). We focused on ATR-101 because of its cytotoxicity in ACC-derived cells and its antixenograft and adrenalytic activities (Cheng et al., 2016). ACC is a rare cancer that has few treatment options. The adrenalytic compound mitotane is a first-line drug for ACC treatment despite its poor efficacy, unfavourable pharmacokinetics, severe side effects and potential drug interactions (Maiter et al., 2016). Clinical trials of molecularly targeted agents...

Background: Nucleoprotein complexes are frequently assumed to adopt a unique configuration. Results: ATF2-Jun heterodimers bound the interferon-␤ enhancer in two opposite orientations in association with IRF3 and HMGI. Opposite heterodimer orientations exhibited the same cooperativity of ATF2-Jun-IRF3-HMGI complex formation, but had distinct transcriptional activities. Conclusion: ATF2-Jun heterodimer orientation did not affect binding cooperativity, but affected transcriptional activity. Significance: Changes in transcription complex configuration can regulate transcriptional activity.

Cells must control genes that are induced by virus infection to mitigate deleterious consequences of inflammation. We investigated the mechanisms whereby Keap1 moderates the transcription of genes that are induced by Sendai virus infection in mouse embryo fibroblasts (MEFs). Keap1−/− deletions increased the transcription of virus induced genes independently of Nrf2. Keap1 moderated early virus induced gene transcription. Virus infection induced Keap1 to bind Ifnb1, Tnf and Il6, and reduced Keap1 binding at Cdkn1a and Ccng1. Virus infection induced G9a‐GLP and NFκB p50 recruitment, and H3K9me2 deposition. Keap1−/− deletions eliminated G9a‐GLP and NFκB p50 recruitment, and H3K9me2 deposition, but they did not affect NFκB p65, IRF3 or cJun recruitment. G9a‐GLP inhibitors (BIX01294, MS012, BRD4770) enhanced virus induced gene transcription in MEFs with intact Keap1, but not in MEFs with Keap1−/− deletions. G9a‐GLP inhibitors augmented Keap1 binding to virus induced genes in infected MEFs, and to cell cycle genes in uninfected MEFs. G9a‐GLP inhibitors augmented NFκB subunit recruitment in MEFs with intact Keap1. G9a‐GLP inhibitors stabilized Keap1 retention in permeabilized MEFs. G9a‐GLP lysine methyltransferase activity was required for Keap1 to moderate transcription, and it moderated Keap1 binding to chromatin. The interdependent effects of Keap1 and G9a‐GLP on the recruitment of each other and on the moderation of virus induced gene transcription constitute a feedback circuit. Keap1 and the electrophile tBHQ reduced virus induced gene transcription through different mechanisms, and they regulated the recruitment of different NFκB subunits. Characterization of the mechanisms whereby Keap1, G9a‐GLP and NFκB p50 moderate virus induced gene transcription can facilitate the development of immunomodulatory agents.