The expression of secreted protein acidic and rich in cysteine (SPARC) has been recently identified to be associated with the pathology of diabetic retinopathy. Therefore, the present study aimed to evaluate the regulatory role of SPARC in human retinal capillary endothelial cells (HRCECs), following exposure to a high glucose environment in vitro. The cell viability, migration, angiogenesis, permeability and SPARC expression levels of HRCECs were measured following treatment with different concentrations of glucose (25, 50 or 100 mM). Lentiviral vectors (LV185-pL_shRNA_mKate2-SPARC-543; target sequence, GGATGAGGACAACAACCTTCT) that inhibit the expression of SPARC were constructed, and HRCECs were evaluated when infected by viruses carrying the lentiviral vectors. Cell viability was examined using the Cell Counting Kit-8 assay. The expression of SPARC in HRCECs increased as the concentration of glucose in the culture medium increased. Relatively high concentrations of glucose significantly inhibited cell proliferation (P<0.05), migration (P<0.05), angiogenesis (P<0.01), and the expression of ZO, occludin, claudin and JAM1 in tight junctions (P<0.01), gap junctions (Cx37 and Cx43; P<0.01) and adherens junctions (VE-cadherin, CTNNA1 and CTNNB1; P<0.05). However, when SPARC was downregulated by lentiviral vectors, the inhibitions induced by high concentrations of glucose were partially reversed. To conclude, the inhibitory effects on cell viability, migration, angiogenesis and cellular adhesion of HRCECs induced by high concentrations of glucose were reversed once the expression of SPARC was inhibited. These findings suggest that SPARC may serve an important role in pathogenesis of diabetic retinopathy.

Background Aberrant post-surgical scarring is responsible for failure of glaucoma filtration surgery (GFS) and is attributed to strong fibrotic process of human Tenon’s fibroblasts (HTFs). Vascular endothelial growth factor (VEGF) and secreted protein, acidic and rich in cysteine (SPARC) contribute to angiogenesis and fibrosis. However, whether SPARC can regulate the VEGF-mediated fibrotic process in HTFs has not been clarified. This study aimed to examine how SPARC and VEGF crosstalk to regulate the expression of Collagen-I and matrix metalloproteinase 9 (MMP9) as well as the ERK signalling in HTFs.Methods Human Tenon's capsule tissues were cultured for preparation of HTFs, which were characterized by immunofluorescence. The effects of VEGF treatment on SPARC, Collagen-I and MMP9 expression and ERK phosphorylation were determined by Western blot, quantitative RT-PCR and immunofluorescence. The proliferation and wound healing induced by VEGF were examined in HTFs and SPARC-silenced HTFs.Results Following successful passages, immunofluorescent assays indicated that HTFs at passages 3-9 displayed unique characters of fibroblasts with Vimentin, but not keratin, expression. Treatment with VEGF significantly up-regulated SPARC, Collagen-I and MMP9 expression and ERK phosphorylation, and promoted the proliferation and wound healing of HTFs. The stimulatory effects of VEGF were significantly mitigated by SPARC silencing in HTFs.Conclusions Our data provided novel evidence that SPARC was crucial for the VEGF-stimulated fibrotic process in HTFs and may be a novel target for anti-fibrotic therapies post GFS.

Background Aberrant post-surgical scarring is responsible for failure of glaucoma filtration surgery (GFS) and is attributed to strong fibrotic process of human Tenon’s fibroblasts (HTFs). Vascular endothelial growth factor (VEGF) and secreted protein, acidic and rich in cysteine (SPARC) contribute to angiogenesis and fibrosis. However, whether SPARC can regulate the VEGF-mediated fibrotic process in HTFs has not been clarified. This study aimed to examine how SPARC and VEGF crosstalk to regulate the expression of Collagen-I and matrix metalloproteinase 9 (MMP9) as well as the ERK signalling in HTFs. Methods Human Tenon's capsule tissues were cultured for preparation of HTFs, which were characterized by immunofluorescence. The effects of VEGF treatment on SPARC, Collagen-I and MMP9 expression and ERK phosphorylation were determined by Western blot, quantitative RT-PCR and immunofluorescence. The proliferation and wound healing induced by VEGF were examined in HTFs and SPARC-silenced HTFs. Results Following successful passages, immunofluorescent assays indicated that HTFs at passages 3-9 displayed unique characters of fibroblasts with Vimentin, but not keratin, expression. Treatment with VEGF significantly up-regulated SPARC, Collagen-I and MMP9 expression and ERK phosphorylation, and promoted the proliferation and wound healing of HTFs. The stimulatory effects of VEGF were significantly mitigated by SPARC silencing in HTFs. Conclusions Our data provided novel evidence that SPARC was crucial for the VEGF-stimulated fibrotic process in HTFs and may be a novel target for anti-fibrotic therapies post GFS.